Science paper

Anonymous
timer Asked: Nov 20th, 2018
account_balance_wallet $5

Question description

Hello,

In the attachment below there is an article and 5 questions. I want to answer those questions depending in the article. (no quotation) and the answer It should not be long answer for example Q1 just I want to mention the purpose of writing this article as the author's idea and the important of it. However, Q2 needs to explain the all process in figure 1(a,b,c,d,f) then the result(overview). And question 3 needs to summaries the benefit of Figure 1 in the big project(How do the experiments fit into their project).Q4 it is like what do you think the authors will focus on after this article?(basic but clear) the Grammar/Spelling Count!

LETTER doi:10.1038/nature13596 A long noncoding RNA protects the heart from pathological hypertrophy Pei Han1,2, Wei Li1,2*, Chiou-Hong Lin2*, Jin Yang1, Ching Shang2, Sylvia T. Nurnberg2, Kevin Kai Jin2, Weihong Xu3, Chieh-Yu Lin2, Chien-Jung Lin2, Yiqin Xiong2, Huan-Chieh Chien2, Bin Zhou4, Euan Ashley2, Daniel Bernstein5, Peng-Sheng Chen1, Huei-Sheng Vincent Chen6, Thomas Quertermous2 & Ching-Pin Chang1,7,8 The role of long noncoding RNA (lncRNA) in adult hearts is unknown; also unclear is how lncRNA modulates nucleosome remodelling. An estimated 70% of mouse genes undergo antisense transcription1, including myosin heavy chain 7 (Myh7), which encodes molecular motor proteins for heart contraction2. Here we identify a cluster of lncRNA transcripts from Myh7 loci and demonstrate a new lncRNA–chromatin mechanism for heart failure. In mice, these transcripts, which we named myosin heavy-chain-associated RNA transcripts (Myheart, or Mhrt), are cardiac-specific and abundant in adult hearts. Pathological stress activates the Brg1–Hdac–Parp chromatin repressor complex3 to inhibit Mhrt transcription in the heart. Such stress-induced Mhrt repression is essential for cardiomyopathy to develop: restoring Mhrt to the prestress level protects the heart from hypertrophy and failure. Mhrt antagonizes the function of Brg1, a chromatin-remodelling factor that is activated by stress to trigger aberrant gene expression and cardiac myopathy3. Mhrt prevents Brg1 from recognizing its genomic DNA targets, thus inhibiting chromatin targeting and gene regulation by Brg1. It does so by binding to the helicase domain of Brg1, a domain that is crucial for tethering Brg1 to chromatinized DNA targets. Brg1 helicase has dual nucleic-acid-binding specificities: it is capable of binding lncRNA (Mhrt) and chromatinized—but not naked—DNA. This dual-binding feature of helicase enables a competitive inhibition mechanism by which Mhrt sequesters Brg1 from its genomic DNA targets to prevent chromatin remodelling. A Mhrt–Brg1 feedback circuit is thus crucial for heart function. Human MHRT also originates from MYH7 loci and is repressed in various types of myopathic hearts, suggesting a conserved lncRNA mechanism in human cardiomyopathy. Our studies identify a cardioprotective lncRNA, define a new targeting mechanism for ATP-dependent chromatinremodelling factors, and establish a new paradigm for lncRNA– chromatin interaction. By 59 and 39 rapid amplification of complementary DNA ends, we discovered an alternative splicing of Myh7 antisense transcription into a cluster of RNAs of 709 to 1,147 nucleotides (Mhrt RNAs), containing partial sequences of Myh7 introns and exons (Fig. 1a and Supplementary Note). Mhrt RNAs were cardiac-specific (Fig. 1b), present at low levels in fetal hearts, with increasing abundance as the hearts matured and Myh6/ Myh7 ratio increased (Fig. 1c). RNA in situ analysis showed that Mhrt RNAs resided in the myocardium but not endocardium or epicardium (Fig. 1d and Extended Data Fig. 1a). Quantification of nuclear/cytoplasmic RNA in heart extracts revealed that Mhrt transcripts were primarily nuclear RNAs (Fig. 1e). Coding substitution frequencies4,5 of Mhrt RNAs predicted a negative/low protein-coding potential, in vitro translation of Mhrt RNAs yielded no proteins, and ribosome profiling6 revealed no/minimal ribosomes on Mhrt (Fig. 1f, Extended Data Fig. 1b–f and Supplementary Note). Consequently, Mhrt RNAs are non-coding RNAs in cardiomyocyte nuclei. Mhrt RNAs were downregulated by 46–68% in hearts pressureoverloaded by transaortic constriction (TAC)3, beginning by 2 days and lasting for $42 days after TAC (Fig. 2a). Such Mhrt reduction coincided with the TAC-induced Myh6 to Myh7 isoform switch characteristic of cardiomyopathy7–9 (Extended Data Fig. 2a). To define Mhrt function, we focused on Mhrt779, the most abundant Mhrt species, with 779 nucleotides (Fig. 2b, c and Extended Data Fig. 2b–e). We generated a transgenic mouse line to restore Mhrt779 level in stressed hearts. This transgenic line, driven by tetracycline response element (Tre-Mhrt779), was crossed to a cardiac-specific driver line (Tnnt2-rtTA)3 that employs troponin promoter (Tnnt2) to direct expression of reverse tetracycline-dependent transactivator (rtTA). The resulting Tnnt2-rtTA;Tre-Mhrt779 line (abbreviated as Tg779) enabled the use of doxycycline to induce Mhrt779 expression in cardiomyocytes. Within 7–14 days of doxycycline treatment, Mhrt779 increased by ,1.5-fold in left ventricles of Tg779 mice; this offset Mhrt779 suppression in TAC-stressed hearts to maintain Mhrt779 at the pre-stress level (Fig. 2d). Six weeks after TAC, doxycycline-treated control mice (Tre-Mhrt779, Tnnt2-rtTA or wild type) developed severe cardiac hypertrophy and fibrosis with left ventricular dilatation and reduced fractional shortening. Conversely, doxycycline-treated Tg779 hearts—with Mhrt779 maintained at the pre-stress level—developed much less pathology, with a 45.7% reduction in the ventricle/body-weight ratio (Fig. 2e) and a 61.3% reduction in cardiomyocyte size (Fig. 2f and Extended Data Fig. 3a), minimal/absent cardiac fibrosis (Fig. 2g), a 45.5% improvement of fractional shortening (Fig. 2h and Extended Data Fig. 3b), normalized left ventricular size (Fig. 2i), and reduced pathological changes of Anf (also known as Nppa), Bnp (also known as Nppb), Serca2 (also known as Atp2a2), Tgfb1 and Opn (also known as Spp1) expression10–13 (Extended Data Figs 3c and 6e). To further test the cardioprotective effects of Mhrt, we induced Mhrt779 after 1–2 weeks of TAC when hypertrophy had begun. This approach reduced hypertrophy by 23% and improved fractional shortening by 33% in 8 weeks after TAC (Extended Data Fig. 3d–f). The efficacy of late Mhrt779 introduction suggests that a sustained repression of Mhrt in stressed hearts is essential for continued decline of cardiac function. To study Mhrt regulation, we examined the 59 upstream region of the Mhrt genomic site (22329 to 1143) (Extended Data Fig. 4a) for signatures of a lncRNA promoter: RNA polymerase II (Pol II), histone H3 trimethylated lysine 4 (H3K4me3) and histone H3 trimethylated lysine 36 (H3K36me3)4,14,15. By chromatin immunoprecipitation (ChIP) of left ventricles, we found that this putative promoter contained four evolutionarily conserved elements (a1 to a4)3 that were enriched with Pol II 1 Krannert Institute of Cardiology and Division of Cardiology, Department of Medicine, Indiana University School of Medicine, Indianapolis, Indiana 46202, USA. 2Division of Cardiovascular Medicine, Cardiovascular Institute, Stanford University School of Medicine, Stanford, California 94305, USA. 3Stanford Genome Technology Center, Stanford University School of Medicine, Stanford, California 94305, USA. 4Department of Genetics, Pediatrics, and Medicine (Cardiology), Albert Einstein College of Medicine of Yeshiva University, 1301 Morris Park Avenue, Price Center 420, Bronx, New York 10461, USA. 5Department of Pediatrics, Stanford University School of Medicine, Stanford, California 94305, USA. 6Del E. Webb Neuroscience, Aging & Stem Cell Research Center, Sanford/Burnham Medical Research Institute, La Jolla, California 92037, USA. 7Department of Biochemistry and Molecular Biology, Indiana University School of Medicine, Indianapolis, Indiana 46202, USA. 8Department of Medical and Molecular Genetics, Indiana University School of Medicine, Indianapolis, Indiana 46202, USA. *These authors contributed equally to this work. 1 0 2 | N AT U R E | VO L 5 1 4 | 2 O C TO B E R 2 0 1 4 ©2014 Macmillan Publishers Limited. All rights reserved LETTER RESEARCH a 4.1 kb Myh6 b Myh7 Intron 35 Intron 34 10 3 2 1 0 3 2 1 0 Endo. Myocardium art He e ey tin Kid n sc le In t es Mu ym us n P = 0.012–0.028 Epi. f Ribosome/total RNA sequencing count 2.0 1.5 8 1.0 4 0.5 0 Mhrt Adult heart Th er lee Sp ng Liv Lu ain 16 12 Myocardium P4 0 P6 0 P1 20 P9 P3 1 Myocardium RNA Adult hearts, n = 5–7 0 G AP ACDH T TU B H BB PR M T h 1 H rt7 O 7 M TA 9 AL IR N AT EA 1 TU T1 RP G1 H P ER H C 1 2 RM P2 G RP AS 5 30 e In situ hybridization Myh6/Myh7 60 40 20 50 Adult tissues, n = 3 d 1,000 P4 0.5 Common (3′) Alternatively spliced (m) 2,000 P6 1.0 0 Mhrt Myh6/Myh7 8 Exons 1–34 R1 c P2 35 Br Mhrt779 E1 36 Tf IIb H 28 prt S 1 rR N A N ea t1 M hr t Intergenic E1 1 E1 5 37 Nuclear/cytoplasmic ratio of RNA Mhrt826 Exon spliced out of Mhrt Mhrt709 F1 Mhrt828 Poly (A) (AK052874) Common (5′) Mhrt 38 Mhrt857 Intron 100 39 Mhrt1147 Exon spliced into Mhrt 200 40 Expression level normalized to TfIIb 1.5 41 Coding RNAs lncRNAs Figure 1 | Profile of the noncoding RNA Mhrt. a, Schematic illustration of Mhrt RNAs originating from the intergenic region between Myh6 and Myh7 and transcribed into Myh7. Myh7 exons and introns are indicated. m, mid region of the RNAs. F1 and R1, targeting the 59 and 39 Mhrt common sequences, are the primers used for subsequent polymerase chain reaction (PCR). b, Quantitative PCR with reverse transcription (RT–qPCR) of Mhrt RNAs using primers targeting common regions of Mhrt RNAs in tissues from 2-month-old mice. c, RT–qPCR of Mhrt, Myh6 and Myh7 in mouse hearts at different ages. Mhrt and Myh6/Myh7 ratio of embryonic day (E)11 hearts are set as 1. P, postnatal day. d, RNA in situ analysis of Mhrt (blue) in adult hearts. The RNA probe targets all Mhrt species. Red: nuclear fast red. White arrowheads indicate myocardial nuclei. Black arrowheads indicate nuclei of endothelial, endocardial or epicardial cells. Dashed lines demarcate the myocardium from endocardium (Endo.) or from epicardium (Epi.). Scale bars 5 50 mm. e, RT–qPCR of nuclear/cytoplasmic RNA in adult hearts. TfIIb (also known as Gtf2b), Hprt1 and 28S rRNA are primarily cytoplasmic RNAs; Neat1, nuclear lncRNA. TfIIb ratio is set as 1. f, Ribosome profiling: ribosome density on coding RNAs and lncRNAs. P values: Student’s t-test. Error bars show standard error of the mean (s.e.m.). (a1 to a4), H3K4me3 (a1 and a4) and H3K36me3 (refs 14, 16–18) (a1 and a3/a4) (Extended Data Fig. 4a–d). Conversely, no Pol II, H3K4me3 or H3K36me3 enrichment was found in control Shh and Vegfa promoters or in thymus and lungs that did not express Mhrt RNAs (Extended Data Fig. 4b–d). These results reveal an active, cardiac-specific lncRNA promoter controlling Mhrt expression. We then asked how Mhrt was repressed in stressed hearts. We postulated that cardiac stress activated Brg1, leading it to occupy the a1–a4 promoter and to repress Myh6 (ref. 3) and Mhrt in opposite transcription directions (Extended Data Fig. 4a). Indeed, Mhrt repression required Brg1: TAC suppressed Mhrt RNAs in control but not Brg1-null hearts (Tnnt2-rtTA;Tre-Cre;Brg1fl/fl)3 (Extended Data Fig. 4e). To test Brg1 activity on the Mhrt promoter, we cloned the a1–a4 promoter in the Mhrt transcription direction (22329 to 1143) into an episomal luciferase reporter, pREP4, that allows promoter chromatinization19. Brg1 was then transfected into Brg1-deficient SW13 cells20 to reconstitute the Brg1/BAF complex for reporter assays. Brg1 transfection caused a ,50% reduction of Mhrt promoter activity (P , 0.0001), and such Mhrt repression was virtually abolished by Hdac inhibition with trichostatin-A or Parp inhibition d 0.5 1 P = 0.0001 4 h 20 3 = n n n = = 5 4 5 4 = P = 0.0058 P = 0.77 P = 0.39 P = 0.31 3 + 2 P = 0.008 P = 0.65 .7% 23 1 Tg779 + Dox Ctrl + Dox = 5 4 = n n = 7 4 5 = n n = 4 = = Ctrl + Dox n = n = n Tg779 + Dox 7 4 0 Sham TAC Sham TAC Sham TAC Sham TAC 5 4 7 Ctrl + Dox = = n n = 4 Sham TAC Sham TAC n 10 0 TAC 6 wk LVID (mm) 30 LVIDs P = 0.67 4 % n FS (%) .0% –38 Tg779 + Dox LVIDd P = 0.34 5 –2 0.7 n n 50 P = 0.0003 P = 0.0049 40 TAC 6 wk Ctrl + Dox Tg779 + Dox i P = 0.78 P = 0.0023 Ctrl + Dox Sham TAC Sham TAC = = n Ctrl + Dox Tg779 + Dox g % 4.3 +3 2 0 7 11 = = n = n n 4 Sham TAC Sham TAC 6 .4% Cardiomyocyte size +4 4.4 % +81.6 % P = 0.0102 (pixels per cell, ×1,000) P < 0.0001 P < 0.0001 2 0 P < 0.0001 8 P < 0.0001 6 4 5 3 Ctrl Tg779 + Dox + Dox Cardiomyocyte size +89 8 4 Tg779 + Dox Ventricle/body weight (mg g–1) TAC 6 wk f = = n Tg779 Ctrl n 3 n = n 0 Sham TAC TAC + 3 3 6 = – + = 0 Dox – n 4 P = 0.55 TAC Ctrl + Dox Sham 4 826 643 1.0 2 n 7 d 14 d 24 d 42 d 2 Sham Mhrt779 0 P = 0.68 P = 0.001 = c Size controls Negative 643 826 Heart n = 24 12 9 15 e –68.0% –46.4% –53.1% –58.6% –55.4% 0.5 779 709 1.5 3 n Size controls Heart 779 826 709 857/826 1.0 P = 0.027 Relative Mhrt779 expression b Mhrt P = 0.0002–0.036 1.5 d Relative Mhrt expression a Tg779 + Dox Figure 2 | Mhrt inhibits cardiac hypertrophy and failure. a, Quantification of cardiac Mhrt RNAs 2–42 days (d) after TAC operation. b, RT–PCR of Mhrt RNAs in adult heart ventricles. Primers (F1 and R1; Fig. 1a) target Mhrt common regions. Size controls 779, 826 and 709 are PCR products of recombinant Mhrt779, Mhrt826 and Mhrt709, respectively. c, Northern blot of Mhrt RNAs in adult heart ventricles. The probe targets common regions of Mhrt RNAs. Negative: control RNA from 293T cells. Size control 826 is recombinant Mhrt826; 643 (not a distinct Mhrt species) contains the 59 common region of Mhrt. d, Quantification of Mhrt779 in control or Tg779 mice with or without doxycycline (Dox) or TAC operation. Mhrt779-specific PCR primers were used. Ctrl, control mice. e, Ventricle/body-weight ratio of hearts 6 weeks (wk) after TAC. Scale bars 5 1 mm. f, Quantification of cardiomyocyte size in control and Tg779 mice 6 weeks after TAC by wheatgerm agglutinin staining. g, Trichrome staining in control and Tg779 hearts 6 weeks after TAC. Red indicates cardiomyocytes; blue indicates fibrosis. Scale bars 5 20 mm. h, i, Echocardiographic measurement of left ventricular fractional shortening (FS; h) and internal dimensions at end-diastole (LVIDd) and end-systole (LVIDs) (i) 6 weeks after TAC. P values: Student’s t-test. Error bars show s.e.m. 2 O C TO B E R 2 0 1 4 | VO L 5 1 4 | N AT U R E | 1 0 3 ©2014 Macmillan Publishers Limited. All rights reserved RESEARCH LETTER Myh7 Relative RNA to input (%) Mhrt 2 P = 0.009 Tnnt2 1 Mhrt Hprt1 Tnnt2 Anf Bnp Hprt1 Bnp Anf 0 Neonatal heart ventricles Sham TAC Sham TAC TAC TAC TAC TAC TAC TAC Sham TAC IP: IgG Brg1 Brg1 Brg1 IgG IgG Brg1 Ctrl hearts Tg779 hearts Brg1-null hearts P1 hearts 32 16 8.0 4.0 + + + – – + + + + 6 2 MBP MBP–D2 + + + + + – + – + – + – + – + + + 3 2 –61.3% 1 –89.6% 0 Ctrl Tg Brg1, n=3 Ctrl Tg Brg1, n=3 Bromo 1617 1 774 913 Ia GG Ib DExx III 1075 Insertion 1202 1310 C-terminal IV V AxxR VI extension D1 D2 i Free Mhrt779 probe Mhrt779: 50 nM –87.6% D1 D2 DExxc HELICc CTE QLQ HSA Labelled Mhrt779 Unlabelled Mhrt779 tRNA Mhrt779– D2 complex Free Mhrt779 probe Opn promoter 3 Free Mhrt779 probe + Myh7 promoter Helicase core Motif: I Mhrt779– D1/D1D2 complex Mhrt779: 50 nM Brg1 Labelled Mhrt779 Unlabelled Mhrt779 tRNA Mhrt779Brg1 complex 4 0 n=3 n=3 IP: IgG Brg1 D1D2:Mhrt779 molecular ratio 2.0 16 32 8.0 4.0 0 2.0 10 P = 0.012 – 8 + Myh6 promoter 4 g EMSA + Vector Mhrt Vector Mhrt Vector Mhrt n = 4 or 5, each in triplicates D1:Mhrt779 molecular ratio RNA-IP 5 Ctrl Tg IP: Brg1, n=3 120 Fraction of Mhrt779 bound (%) f Enrichment of input (%) G F Br P g1 G FP Br g1 +1 04 0% .9% G F Br P g1 G F Br P g1 0 +2 G F Br P g1 G F Br P g1 –28 .8% 8. Myh6 P = 0.0011 P = 0.004 % 2 P = 0.026 1.2 3 +5 Myh7 P < 0.0001 4 +220.5 % Opn P = 0.0018 P = 0.040 5 h = = Brg1, n = 3–4 IgG, n = 3–4 Mhrt 5% n n P = 0.022 3 e TAC d Mhrt –6 1. Ctrl Tg Ctrl Tg Sham 4 1 –76.0% 0 ChIP relative to input (%) c 20 3 Heart Kidney Liver Thymus Brain 40 8 Mhrt Myh6 55,590,000 a4 8 a3 = Promoter mm9 55,589,000 55,588,000 a2 = a1 P = 0.150 n 2 kb 55,587,000 55,586,000 60 n Chr 14: Scale Relative luciferase activity Myh7/6 ratio b RNA expression a r2 = 0.94 D1D2 Figure 3 | Mhrt complexes with Brg1 through the helicase domain. a, DNaseI digital footprinting of Myh6/Mhrt promoter loci from ENCODE. Myh6 and Mhrt are transcribed in opposite directions as indicated by arrows. Bars represent DNA fragments protected from DNaseI digestion. Black boxes (a1–a4) refer to promoter regions with high sequence homology (Extended Data Fig. 4a). b, Quantification of Myh7/Myh6 ratio in control (Ctrl) and Tg779 (Tg) hearts 2 weeks after TAC. c, RNA-immunoprecipitation (IP) of Mhrt–Brg1 in ventricles from control hearts (Ctrl) with sham/TAC operation; Tg779 hearts after TAC; Brg1-null (Tnnt2-rtTA;Tre-Cre;Brg1fl/fl) hearts after TAC; and P1 hearts. d, ChIP analysis of Brg1 in control (Ctrl) and Tg779 hearts 2 weeks after TAC. e, Luciferase reporter assay of Myh6 and Myh7 promoters in neonatal rat cardiomyocytes. Mhrt, pAdd2-Mhrt779; Vector, pAdd2 empty vector. f, RNA-IP and EMSA of recombinant Brg1 proteins and in vitro transcribed Mhrt779. Biotinlabelled Mhrt779: 50 nM; unlabelled Mhrt779: 500 nM. g, Schematics of mouse Brg1 protein. The helicase core includes the DExx-c and HELIC-c domain. h, EMSA of Mhrt779 and Brg1 helicase. i, Binding affinity of Mhrt779 for MBP-tagged D1D2 determined by EMSA. Data are from multiple independent measurements. Nonlinear regression curves were generated by GraphPad Prism. P values: Student’s t-test. Error bars show s.e.m. r2 = 0.96 80 D1 40 D1D2, Kd = 0.76 ± 0.21 μM D1, Kd = 1.8 ± 0.38 μM D2, Kd > 150 μM MBP, no binding n = 3–5, each group 20 10 r2 = 0.92 0 0 with PJ-34 (ref. 21) (Extended Data Fig. 4f), indicating a cooperative repressor function between Brg1, Hdac and Parp. ChIP verified that the Mhrt promoter (a1–a4) was occupied by Brg1, Hdac2/9 and Parp1 in stressed hearts3 and in the pREP4 reporter episome (Extended Data Fig. 4g). These findings indicate that Mhrt is repressed by the stressinduced Brg1–Hdac–Parp complex3 through the a1–a4 promoter. Because Myh6 and Mhrt were both regulated by the a1–a4 promoter, we hypothesized that a1–a4 contained two elements to regulate Myh6 and Mhrt—with the a1 element controlling Myh6 and the a3/4 element controlling Mhrt (Extended Data Fig. 4a). On a1 and a3/4 (but not a2), we found cardiac-specific enrichment of Brg1 (ref. 3), H3K4me3 and H3K36me3 (Extended Data Fig. 4c–d), and DNaseI genomic footprints (Fig. 3a)22. To test a3/4 for Mhrt regulation, we conducted deletional analysis of the a1–a4 promoter in the Mhrt transcription direction. In reporter assays, a3/4 was necessary and sufficient for Mhrt promoter activity and for Brg1-dependent Mhrt repression, whereas a1 was not essential for either (Extended Data Fig. 4h). Conversely, a1 is necessary and sufficient for Brg1 to repress the Myh6 promoter3, but a3/4 is not required3. Therefore, a1 and a3/4 are two functionally distinct elements for Brg1 to separately control Myh6 and Mhrt. In stressed hearts, Brg1 represses Myh6 and activates Myh7 (ref. 3), causing a pathological switch of Myh6/7 expression, contributing to cardiomyopathy23. This stress/Brg1-dependent Myh switch was largely eliminated by Mhrt779 (Fig. 3b), and the inhibition of the Myh switch by Mhrt did not involve RNA–RNA sequence interference between Mhrt and Myh (Extended Data Fig. 5a–j and Supplementary Note). Instead, it required a physical interaction between Mhrt RNA and Brg1. RNA D2 MBP r2 = 0.68 0.8 1.6 2.4 3.2 4.0 Protein concentration (μM) immunoprecipitation of TAC-stressed adult hearts or Brg1-expressing neonatal hearts showed that Brg1 co-immunoprecipitated with Mhrt779 but not control RNAs, and that Mhrt779 complexed with Brg1 but not with the polycomb proteins Ezh2 or Suz12 (Fig. 3c and Extended Data Fig. 6a, b). The Brg1–Mhrt complex was minimal in unstressed adult hearts with low Brg1 (ref. 3) or in stressed Brg1-null hearts (Tnnt-rtTA; Tre-Cre;Brg1fl/fl)3 (Fig. 3c and Supplementary Note). These results suggest that Mhrt binds to Brg1 to influence its gene regulation. We then tested how Mhrt regulated Brg1 activity on its in vivo target genes, including Myh6 (ref. 3), Myh7 (ref. 3) and Opn (osteopontin, critical for cardiac fibrosis12) (Extended Data Fig. 6c–e and Supplementary Note). In doxycycline-treated, TAC-stressed Tg799 hearts, Mhrt779—without affecting the Brg1 messenger RNA/protein level (Extended Data Fig. 7a–f)— reduced Brg1 occupancy on Myh6, Myh7 and Opn promoters by 60–90% (Fig. 3d), causing a 56–76% loss of Brg1-controlled Myh switch and Opn activation (Fig. 3b and Extended Data Figs 6e, 7g). We then used primary rat ventricular cardiomyocytes to conduct reporter assays. In these cells, as observed in vivo, Brg1 repressed Myh6 and activated Myh7 and Opn promoters; Mhrt779 reduced Brg1 activity on these promoters by 54–80% (Fig. 3e). Accordingly, Mhrt prevents Brg1 from binding to its genomic targets to control gene expression. How Brg1 or ATP-dependent chromatin remodellers recognize their target promoters is an important but not fully understood issue in chromatin biology. Biochemically, recombinant Brg1 proteins and in vitro transcribed Mhrt779 could directly co-immunoprecipitate without involving other factors (Fig. 3f). An electrical mobility shift assay (EMSA) showed that Brg1 shifted biotin-labelled Mhrt779 to form a low mobility 1 0 4 | N AT U R E | VO L 5 1 4 | 2 O C T O B E R 2 0 1 4 ©2014 Macmillan Publishers Limited. All rights reserved LETTER RESEARCH IgG Brg1 IgG Brg1 3 = = Chromatinized Myh6 n MBP n n = 3 3 0 MBP–D1D2 P = 0.59 1 Relative luciferase activity 2 3 Histone H3 P = 0.036 3 = ChIP relative to input (%) +Amylose +Amylose +MBP +Amylose +MBP–D1D2 g 4 n f Amylose pull-down Histone input Anti-histone H3 4 4 = = n n 3 3 = = n = n Ctrl Mhrt Myh6 nucleosomal DNA + D1D2 Nucleosomal DNA + D1D2 Nucleosomal Naked Myh6 promoter –58.4% 2 0 Myh6 Neo 5S rDNA 3 0 3 3 = n Per cent of DNA input 2 4 n Per cent of DNA input 4 e 6 P = 0.0058 Anti-MBP n = = n d P = 0.033 P = 0.0006 6 Naked Myh6 Naked Myh6 promoter 1.5 P = 0.96 1.0 0.5 0 GFP Brg1 n = 4, each in triplicates i 1.0 0.5 0 20 j P = 0.022 15 10 P = 0.90 5 –84.7% 0 Brg 1 Brg1 Brg 1 Brg1 Vector Mhrt Vector Mhrt GFP Brg1 ΔD1 ΔD2 Chromatinized Genomic Myh6, n = 3 GAPDH, n = 3 Relative expression of MHRT n = 4, each in triplicates Chromatin enrichment relative to IgG Chromatinized Myh6 promoter P = 0.97 P = 0.44 1.5 P = 0.025 Chromatin enrichment relative to IgG h MBP D1D2 MBP D1D2 3 0 5S rDNA Myh6 Neo 0 = 20 2 n 40 4 3 60 = 80 n + Per cent of DNA input – = + DNA ladder – n 1–3 nucleosomes + c 6 P = 0.0004 4 1–3 nucleosomes – b P = 0.29 P = 0.44 P = 0.98 = 1 nucleosome Histones 100 n Neo 512 bp 4 Myh6 596 bp 4 5S rDNA 208 bp Fraction of nucleosomal DNA (%) a l 60 P = 0.016 P = 0.032 P = 0.0088 0 15 P = 0.0046–0.0082 5 0 4.1 kb MYH6 Exons 37–40 36 Intron GFP Brg1 ΔD1 ΔD2 Chromatinized Myh6 promoter, n = 4 Strand-specific RT–PCR bp R2 R1 RT primer 1,650 MYH7 35 Exon spliced into MHRT 10 m 35 32 31 34 33 32 31 Exons 1–30 Human MHRT Exon spliced out of MHRT n 1,000 850 650 MH RT (F1 + R1) 500 F1 Mhrt–Brg1 feedback circuit F2 R2 R1 F2 + R2 Binding of Brg1 to genomic DNA targets Helicase core Myh6 40 20 k –65.9% –72.8% –82.8% D1 BAF complex Ctrl LVH ICM IDCM n=4 n=5 n=3 n=6 D2 CT Brg1 Helicase core g din bin in H3 a E: dom Mhrt Cardiac stress 3 AH H2 B H4 H2 Mhrt Mhrt, Myh, Opn, other targets Bromodomain Ac Acetylated H3/H4 tails DNA Figure 4 | Mhrt inhibits chromatin targeting and gene regulation by Brg1. a, Gel electrophoresis and quantification of nucleosomal 5S rDNA, the Myh6 promoter and Neo DNA. Arrowheads indicate the DNA–histone complex; arrows indicate naked DNA. Nucleosome assembly efficiency is defined as the fraction of DNA bound to histones (arrowheads). b–d, Quantification of amylose pull-down of MBP–D1D2 (D1D2) with nucleosomal and naked Myh6 promoter DNA (b), with nucleosomal Myh6 promoter, Neo and 5S rDNA (c), or with nucleosomal Myh6 promoter in the presence of Mhrt779 (d). e, Amylose pull-down of MBP–D1D2 and histone H3. Anti-histone H3 and anti-MBP antibodies were used for western blot analysis. f, ChIP analysis of Brg1 on chromatinized and naked Myh6 promoter in rat ventricular cardiomyocytes. GFP, green fluorescent protein control. g, h, Luciferase reporter activity of Brg1 on naked Myh6 promoter (g) or of helicase-deficient Brg1 on chromatinized Myh6 promoter (h) in rat ventricular cardiomyocytes. DD1, Brg1 lacking amino acid 774–913; DD2, Brg1 lacking 1086–1246. ChIP: H-10 antibody recognizing N terminus, non-disrupted region of Brg1. i, j, ChIP analysis in SW13 cells of chromatinized Myh6 promoter in the presence of Mhrt779 (i) or helicase-deficient Brg1 (j). Mhrt, pAdd2-Mhrt779; Vector, pAdd2 empty vector. k, Schematic illustration and PCR of human MHRT. MHRT originates from MYH7 and is transcribed into MYH7. MYH7 exons and introns are indicated. R1 and R2 are strand-specific primers; F1 and R1 target MHRT and MYH7; F2 and R2 are specific for MHRT. l, Quantification of MHRT in human heart tissues. Ctrl, control; ICM, ischaemic cardiomyopathy; IDCM, idiopathic dilated cardiomyopathy; LVH, left ventricular hypertrophy. m, Working model of a Brg1–Mhrt feedback circuit in the heart. Brg1 represses Mhrt transcription, whereas Mhrt prevents Brg1 from recognizing its chromatin targets. Brg1 functions through two distinct promoter elements to bidirectionally repress Myh6 and Mhrt expression. n, Molecular model of how Brg1 binds to its genomic DNA targets. Brg1 helicase (D1D2) binds chromatinized DNA, C-terminal extension (CTE) binds histone H3, and bromodomain binds acetylated histone H3 or H4. P values: Student’s t-test. Error bars show s.e.m. protein–RNA complex that was competitively disrupted by unlabelled Mhrt779 (Fig. 3f). Brg1, which belongs to the SWI/SNF family of chromatin-remodelling factors, contains a helicase/ATPase core that is split by an insertion into two RecA-like domains: DEAD-like helicase superfamily C-terminal domain, D1 (DExx-c) and helicase superfamily C-terminal domain, D2 (HELIC-c)24,25, with signature motifs of DEADbox, superfamily 2 RNA helicase25,26 (Fig. 3g and Extended Data Fig. 8). SWI/SNF proteins although conserved with RNA helicases, were observed to bind DNA27 and mediate DNA structural changes and repair19. The binding properties of Brg1 remained undefined. To test whether Mhrt could bind to Brg1 helicase, we generated maltose-binding protein (MBP)-tagged recombinant proteins that contained the Brg1 DExx-c domain (MBP–D1, amino acids 774–913), the HELIC-c domain with C-terminus extension (MBP–D2, 1086–1310), or the entire helicase (MBP– D1D2, 774–1310) (Extended Data Fig. 9a). D1D2 showed the highest Mhrt binding affinity (dissociation constant (Kd) 5 0.76 mM); D1 showed moderate affinity (Kd 5 1.8 mM); D2 modest affinity (Kd . 150 mM); and MBP did not bind at all (Fig. 3h, i). Therefore, Brg1 helicase binds Mhrt with high affinity. Contrary to its potent RNA binding, Brg1 helicase showed no detectable binding to the naked DNA of the Myh6 promoter (596 bp, 2426 to 1170, critical for the control of Myh6 by Brg1 (ref. 3)) (Extended Data Fig. 9b). To test whether Brg1 helicase could bind chromatinized DNA, we generated nucleosomal DNA in vitro by assembling histone octamers (histones H2A, H2B, H3 and H4)28 on Myh6 promoter DNA, as well as on control neomycin phosphotransferase gene (Neo) and 5S ribosomal (r)DNA (5S rDNA). We achieved 50–65% efficiency of nucleosome assembly, comparable between Myh6, Neo and 5S rDNA (Fig. 4a). Because the large nucleosome size precluded a clear EMSA resolution, we used amylose to pull down MBP-tagged D1D2 proteins. We found that D1D2 pulled down nucleosomal Myh6 promoter DNA but not the naked one (Fig. 4b). The pull-down efficiency of nucleosomal Myh6 was ,3–6fold that of Neo or 5S rDNA (Fig. 4c), and Mhrt779 was capable of disrupting D1D2–Myh6 pull-down (Fig. 4d). Although D1D2 bound to histone H3 (Fig. 4e), histone binding was insufficient to anchor D1D2 to nucleosomal DNA, as D1D2 bound poorly to nucleosomal Neo and 5S rDNA that also contained histones (Fig. 4c). Therefore, chromatinized DNA targets are biochemically recognized by Brg1 helicase, and this process is inhibited by Mhrt. To test the ability of Brg1 to distinguish chromatinized from naked DNA promoters in cells, we cloned Myh6 promoter into the luciferase reporter plasmid pREP4 (allowing promoter chromatinization19) and pGL3 (containing naked, non-chromatinized promoter). In rat ventricular cardiomyocytes and SW13 cells, ChIP and luciferase analyses showed that Brg1 bound and repressed chromatinized but not naked Myh6 promoter (Fig. 4f, g and Extended Data Fig. 9c, d). However, without D1/D2 domain or in the presence of Mhrt, Brg1 was unable to bind or repress chromatinized Myh6 promoter (Fig. 4h–j and Extended Data Fig. 9e), indicating the necessity of D1D2 for the interaction between Brg1, chromatin and Mhrt. Consistently, all our genetic, biochemical and cellular 2 O C TO B E R 2 0 1 4 | VO L 5 1 4 | N AT U R E | 1 0 5 ©2014 Macmillan Publishers Limited. All rights reserved RESEARCH LETTER studies show that Brg1 requires the helicase domain to bind to chromatinized DNA targets, and Mhrt seizes the helicase to disrupt Brg1–chromatin binding. We then asked how Brg1 surpassed its basal suppression by Mhrt to control Myh, Mhrt, Opn, or other genes to trigger cardiomyopathy (Supplementary Note). Amylose pull-down experiments showed that Brg1 dose-dependently escaped from Mhrt inhibition to occupy Mhrt promoter (Extended Data Fig. 10). Brg1 protein, which increases under stress conditions3, could therefore outrun Mhrt and gain control over the Mhrt promoter to repress Mhrt expression and tip the balance towards Brg1. Contrary to the endogenous Mhrt that was repressible by Brg1, the Mhrt transgene (Tg779)—driven by Tnnt2/Tre promoters—was not subject to repression by Brg1 and was thus able to keep Mhrt at pre-stress levels to inhibit Brg1 and reduce hypertrophy. This further demonstrates the necessity of Mhrt repression for myopathy to develop. Human MYH7 loci encoded RNA that resembled Mhrt in primary sequence and secondary structure, as predicted by minimal free energy29 (Fig. 4k and Extended Data Fig. 11a, b). Human MHRT was also repressed in stressed hearts, with 82.8%, 72.8% and 65.9% reduction of MHRT in hypertrophic, ischaemic or idiopathic cardiomyopathy tissues, respectively (Fig. 4l and Extended Data Fig. 11c). This suggests a conserved MHRT mechanism of human cardiomyopathy. Mhrt is the first example, to our knowledge, of a lncRNA that inhibits myopathy and chromatin remodellers. Reciprocal Mhrt–Brg1 inhibition constitutes a feedback circuit critical for maintaining cardiac function (Fig. 4m). The helicase core of Brg1, combined with the histone-binding domains of the Brg1/BAF complex, adds a new layer of specificity control to Brg1/BAF targeting and chromatin remodelling (Fig. 4n). The Mhrt–helicase interaction also exemplifies a new mechanism by which lncRNA controls chromatin structure. To further elucidate chromatin regulation, it will be essential to define helicase domain function in all ATPdependent chromatin-remodelling factors and to identify new members of lncRNA that act through this domain to control chromatin. The cardioprotective Mhrt may have translational value, given that RNA can be chemically modified and delivered as a therapeutic drug. This aspect of lncRNA–chromatin regulation may also inspire new therapies for human disease. Tg779 mouse generation, rapid amplification of cDNA ends (RACE), RNA in situ hybridization, RT–qPCR, codon substitution frequencies (CSF), echocardiography, northern blot, EMSA, ChIP, RNA immunoprecipitation, reporter assay, nucleosome assembly, and the amylose pull-down assay were performed as described3,4,28. Online Content Methods, along with any additional Extended Data display items and Source Data, are available in the online version of the paper; references unique to these sections appear only in the online paper. Received 25 March 2013; accepted 17 June 2014. Published online 10 August; corrected online 1 October 2014 (see full-text HTML version for details). 2. 3. 4. 5. 6. 8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18. 19. 20. 21. 22. 23. 24. 25. 26. 27. 28. 29. METHODS SUMMARY 1. 7. RIKEN Genome Exploration Research Group and Genome Science Group (Genome Network Project Core Group) and the FANTOM Consortium. Antisense transcription in the mammalian transcriptome. Science 309, 1564–1566 (2005). Haddad, F., Bodell, P. W., Qin, A. X., Giger, J. M. & Baldwin, K. M. Role of antisense RNA in coordinating cardiac myosin heavy chain gene switching. J. Biol. Chem. 278, 37132–37138 (2003). Hang, C. T. et al. Chromatin regulation by Brg1 underlies heart muscle development and disease. Nature 466, 62–67 (2010). Hung, T. et al. Extensive and coordinated transcription of noncoding RNAs within cell-cycle promoters. Nature Genet. 43, 621–629 (2011). Lin, M. F., Jungreis, I. & Kellis, M. PhyloCSF: a comparative genomics method to distinguish protein coding and non-coding regions. Bioinformatics 27, i275–i282 (2011). Ingolia, N. T., Brar, G. A., Rouskin, S., McGeachy, A. M. & Weissman, J. S. The ribosome profiling strategy for monitoring translation in vivo by deep sequencing of ribosome-protected mRNA fragments. Nature Protocols 7, 1534–1550 (2012). van Rooij, E. et al. Control of stress-dependent cardiac growth and gene expression by a microRNA. Science 316, 575–579 (2007). Miyata, S., Minobe, W., Bristow, M. R. & Leinwand, L. A. Myosin heavy chain isoform expression in the failing and nonfailing human heart. Circ. Res. 86, 386–390 (2000). Lompre, A. M. et al. Myosin isoenzyme redistribution in chronic heart overload. Nature 282, 105–107 (1979). Schultz, J. J. et al. TGF-b1 mediates the hypertrophic cardiomyocyte growth induced by angiotensin II. J. Clin. Invest. 109, 787–796 (2002). Molkentin, J. D. & Dorn, G. W. II. Cytoplasmic signaling pathways that regulate cardiac hypertrophy. Annu. Rev. Physiol. 63, 391–426 (2001). López, B. et al. Osteopontin-mediated myocardial fibrosis in heart failure: a role for lysyl oxidase? Cardiovasc. Res. 99, 111–120 (2013). Frey, N. & Olson, E. N. Cardiac hypertrophy: the good, the bad, and the ugly. Annu. Rev. Physiol. 65, 45–79 (2003). Guttman, M. et al. Chromatin signature reveals over a thousand highly conserved large non-coding RNAs in mammals. Nature 458, 223–227 (2009). Rando, O. J. & Chang, H. Y. Genome-wide views of chromatin structure. Annu. Rev. Biochem. 78, 245–271 (2009). Hahn, M. A., Wu, X., Li, A. X., Hahn, T. & Pfeifer, G. P. Relationship between gene body DNA methylation and intragenic H3K9me3 and H3K36me3 chromatin marks. PLoS ONE 6, e18844 (2011). Mikkelsen, T. S. et al. Genome-wide maps of chromatin state in pluripotent and lineage-committed cells. Nature 448, 553–560 (2007). Musselman, C. A. et al. Molecular basis for H3K36me3 recognition by the Tudor domain of PHF1. Nature Struct. Mol. Biol. 19, 1266–1272 (2012). Liu, R. et al. Regulation of CSF1 promoter by the SWI/SNF-like BAF complex. Cell 106, 309–318 (2001). Muchardt, C. & Yaniv, M. A human homologue of Saccharomyces cerevisiae SNF2/ SWI2 and Drosophila brm genes potentiates transcriptional activation by the glucocorticoid receptor. EMBO J. 12, 4279–4290 (1993). Szabó, G. et al. Poly(ADP-ribose) polymerase inhibition reduces reperfusion injury after heart transplantation. Circ. Res. 90, 100–106 (2002). Hesselberth, J. R. et al. Global mapping of protein–DNA interactions in vivo by digital genomic footprinting. Nature Methods 6, 283–289 (2009). Gupta, M. P. Factors controlling cardiac myosin-isoform shift during hypertrophy and heart failure. J. Mol. Cell. Cardiol. 43, 388–403 (2007). Clapier, C. R. & Cairns, B. R. The biology of chromatin remodeling complexes. Annu. Rev. Biochem. 78, 273–304 (2009). Jankowsky, E. & Fairman, M. E. RNA helicases—one fold for many functions. Curr. Opin. Struct. Biol. 17, 316–324 (2007). Mallam, A. L., Del Campo, M., Gilman, B., Sidote, D. J. & Lambowitz, A. M. Structural basis for RNA-duplex recognition and unwinding by the DEAD-box helicase Mss116p. Nature 490, 121–125 (2012). Dürr, H., Korner, C., Muller, M., Hickmann, V. & Hopfner, K. P. X-ray structures of the Sulfolobus solfataricus SWI2/SNF2 ATPase core and its complex with DNA. Cell 121, 363–373 (2005). Feng, Y. et al. Histone H4 acetylation differentially modulates arginine methylation by an in cis mechanism. J. Biol. Chem. 286, 20323–20334 (2011). Zuker, M. On finding all suboptimal foldings of an RNA molecule. Science 244, 48–52 (1989). Supplementary Information is available in the online version of the paper. Acknowledgements We thank C.-H. Chen for assisting with echocardiography; L. Chen, A. Kuo and G. Crabtree for transgene injection and northern blot; M. Ecarkt and E. Zuo for ribosome analysis. C.-P.C. was supported by the American Heart Association (AHA; Established Investigator Award 12EIA8960018), National Institutes of Health (NIH; HL118087, HL121197), March of Dimes Foundation (#6-FY11-260), California Institute of Regenerative Medicine (CIRM; RN2-00909), Oak Foundation, Baxter Foundation, Stanford Heart Center Research Program, Indiana University (IU) School of Medicine—IU Health Strategic Research Initiative, and the IU Physician-Scientist Initiative, endowed by Lilly Endowment. W.L. and Y.X. were supported by the Oak Foundation; Y.X. by the AHA and Lucile Packard Children’s Foundation; C.S. by an NIH fellowship; T.Q. by NIH (HL109512); H.-S.V.C. by CIRM (RB2-01512, RB4-06276) and NIH (HL105194); P.-S.C. by NIH (HL78931, HL71140); B.Z. by NIH (HL116997, HL111770). Author Contributions C.-P.C. and P.H. were responsible for the original concepts, design and manuscript preparation. W.L. and C.-H.L. contributed equally to the work. P.H. conducted most experiments; W.L. and J.Y. assisted with TAC, echo and reporter analyses; C.-H.L. assisted with protein purification; S.T.N. assisted with ribosome data analysis; K.K.J. assisted with protein sequence and motif analysis; C.S. assisted with western blot studies; W.X. assisted with CSF scoring; Y.X. assisted with RNA/protein staining; C.-J.L. and C.-Y.L. assisted with Brg1-null tissue preparation and H-10 antibody-ChIP optimization; H.-C.C. assisted with cloning; H.-S.V.C. assisted with tissue collection; E.A. assisted with tissue collection/rat tissue supply; B.Z. assisted with driver line generation; D.B., P.-S.C. and T.Q. assisted with data analysis. Author Information Data have been deposited in the Gene Expression Omnibus under accession number GSE49716. Reprints and permissions information is available at www.nature.com/reprints. The authors declare no competing financial interests. Readers are welcome to comment on the online version of the paper. Correspondence and requests for materials should be addressed to C.-P.C. (changcp@iu.edu). 1 0 6 | N AT U R E | VO L 5 1 4 | 2 O C T O B E R 2 0 1 4 ©2014 Macmillan Publishers Limited. All rights reserved LETTER RESEARCH METHODS Mice, animal sample size, and randomization. For the generation of Tg779 mice, Mhrt779 was cloned into the pTRE2 backbone (Clonetech). A DNA fragment containing the Tre promoter and Mhrt779 were injected into the pronucleus of fertilized oocytes (B6C3H/F1). Embryos were implanted into a pseudopregnant CD-1 mouse. The Tre-Mhrt779 transgene was identified by PCR genotyping using primers CGCCTGGAGACGCCATCCAC and TGTCTTCAAAGCTGACTCCCT. Tre-Mhrt779 mice with ,3 copies of the transgene were backcrossed with Tnnt2rtTA mice as described previously3,30 to generate Tnnt2-rtTA;Tre-Mhrt779 (Tg779) mice. The number of animals used (n) is denoted in each test in the figures, including technical replicates when applicable. We routinely used mouse littermates to control and perform our experiments. Each subgroup of experiments had n 5 3 to 14 biological replicates, many of which had technical replicates of three. Assignment to each experimental subgroup was based on genotypes. Littermate mice with the same genotypes regardless of gender were randomly selected from the cage and assigned to different control and experimental subgroups. Major procedures were blinded. The use of mice for studies was in compliance with the regulations of Indiana University, Stanford University and the National Institutes of Health. RACE and cloning of full length of Mhrt transcripts. The 39 and 59 RACE were performed using the FirstChoice RLM-RACE Kit (Ambion) following the manufacturer’s instruction. RNA was extracted from adult heart ventricles. Primers used for 39 and 59 RACE were designed based on the known sequence information: TC ATTGGCACGGACAGCATC (first-round Mhrt 39-prime specific) and GAGCA TTTGGGGATGGTATAC (second-round Mhrt 39-prime specific); CAACACTT TTCATTTTCCTCTTT (first-round Mhrt 59-prime specific) and TCTGCTTCA TTGCCTCTGTTT (second-round Mhrt 59-prime specific). Once we reached the 59 and 39 cDNA ends, we used primers F1 (Fig. 1a; AAGAGCCCTACAGTCTG ATGAACA) and R1 (Fig. 1a; CCTTCACACAAACATTTTATTT) to amplify the full-length Mhrt transcripts and cloned them into pDrive TA cloning vector (Qiagen) for sequencing. Mhrt RNAs were also further cloned into shuttle vector pAdd2 (refs 31, 32) for expression in cells. Northern blot and in situ hybridization. We obtained 5 mg of total RNA using Quick-RNA Mini Kit (Zymo Research). RNA blot was performed using NorthernMax Kit (Ambion) following the manufacturer’s protocol. Single-stranded RNA probe was generated by in vitro transcription with MaxIscript SP6/T7 kit (Ambion) with ATP [a-32P] (PerkinElmer) using full-length Mhrt779, Myh6 and Myh7 as the template and followed by digestion with DNase I (Ambion). Hybridization was performed at 65 uC. The blot was washed and imaged by Phosphor storage scanning by Typhoon 8600 Imager (GE Healthcare). In situ hybridization experiments were performed as previously described3,33. RNA fractionation. To isolate cytosolic and nuclear RNAs from adult heart tissues, we used a PARIS kit (Ambion) and followed the manufacturer’s instruction. Ten milligrams of tissue were homogenized in cell fractionation buffer thoroughly before centrifuging for 5 min at 500g. Supernatant was collected as the cytosolic fraction, while the nuclear pellet was washed and lysed by cell disruption buffer. Such samples were further mixed with 23 lysis/binding solution before extracting RNA using the manufacturer’s protocol. Codon substitution frequency predication. To measure the coding potential of Mhrt, we used the previously described codon substitution frequencies (CSF) method4,5 to evaluate the evolutionary characteristics in their alignments with orthologous regions in six other sequenced mammalian genomes (rat, human, hamster, rhesus monkey, cat and dog). CSF generates a likelihood score for a given sequence considering all codon substitutions observed within its alignment across multiple species, which was based on the relative frequency of similar substitutions occurring in known coding and noncoding regions. CSF compares two empirical codon models; one generated from alignments of known coding regions and the other according to noncoding regions, producing a likelihood ratio. The ratio reflects whether the protein-coding model better explains the alignment. Ribosome profiling and RNA deep sequencing. For ribosome profiling6, overexpression of the predominant species of Mhrt (Mhrt779) along with HOTAIR were achieved through co-transfecting pAdd2-779 and pAdd2-HOTAIR into SW13 cells. The cells were then lysed to extract ribosome-associated RNA fragments using ARTseq Ribosome Profiling Kit (Epicentre, Illumina). The RNA fragments were further converted into a DNA library through end repair, adaptor ligation, reverse transcription circularization, and PCR amplification. A conventional RNA-seq library was also prepared, with total RNA extracted from those cells with an miRNeasy Mini Kit (Qiagen #217004). The libraries were further processed according to an MiSeq Sample Prep sheet, and an MiSeq 50 cycle kit was used for sequencing. PCR products (1.25 pmol) were used for sequencing. Approximately 600,000–700,000 reads were properly paired and used for further analysis. The resulting reads were aligned to the human hg19 or mouse mm10 genome using Bowtie2 v.2.0.0.6 (ref. 34). Mapped reads were visualized on the UCSC browser as bigwig files generated using samtools v.0.1.18 (ref. 35), bedtools v.2.16.1 (ref. 36), bedClip and bedGraphToBigWig. For quantification of fragments per kilobase of exon per million fragments mapped (FPKM) values, cuffdiff as part of the tophat suite v.2.0.8b37 was run on a merged bam file containing the human and the Mhrt reads using a custom gtf file comprising the human hg19 iGenome and the Mhrt transcripts. To generate scatter plots of the genes, cuffdiff files were used for visualization with cummerbund v.2.3.1 (ref. 37). In vitro translation and biotin labelling. TNT Quick Coupled Transcription/ Translation System (Promega) was used for in vitro translation. Briefly, 1 mg plasmids of control (luciferase) and various Mhrt species inserted into pDrive vector were added to 40 ml rabbit reticulocyte lysates containing 35S-methionine. After 1 h of incubation, the reactions were analysed on 10–20% Tris-Tricine gel. The gel was dried and visualized by the Typhoon 8600 Imager (GE Healthcare). Biotin-NTP was added to the in vitro translation reaction. Total RNAs were extracted and the biotin-labelled RNAs were detected subsequently by IRDye 680 Streptavidin (LiCOR, 926-68079) using an Odyssey Infrared Imaging System. TAC. The TAC surgery was performed as described3 on adult mice of 8–10 weeks of age and between 20 and 25 g in weight. Mice were fed with doxycycline food pellets (6 mg doxycycline per kg of food; Bioserv) 7–14 days before the TAC operation. Mice were anaesthetized with isoflurane (2–3%, inhalation) in an induction chamber and then intubated with a 20-gauge intravenous catheter and ventilated with a mouse ventilator (Minivent, Harvard Apparatus). Anaesthesia was maintained with inhaled isoflurane (1–2%). A longitudinal 5 mm incision of the skin was made with scissors at the midline of sternum. The chest cavity was opened by a small incision at the level of the second intercostal space 2–3 mm from the left sternal border. While opening the chest wall, the chest retractor was gently inserted to spread the wound 4–5 mm in width. The transverse portion of the aorta was bluntly dissected with a curved forceps. Then, 6-0 silk was brought underneath the transverse aorta between the left common carotid artery and the brachiocephalic trunk. One 27-gauge needle was placed directly above and parallel to the aorta. The loop was then tied around the aorta and needle, and secured with a second knot. The needle was immediately removed to create a lumen with a fixed stenotic diameter. The chest cavity was closed by 6-0 silk suture. Shamoperated mice underwent similar surgical procedures, including isolation of the aorta and looping of the aorta, but without tying of the suture. The pressure load caused by TAC was verified by the pressure gradient across the aortic constriction measured by echocardiography. Only mice with a pressure gradient .30 mm Hg were analysed for cardiac hypertrophy, echocardiography and other purposes. Echocardiography. The echocardiographer was blinded to the genotypes and surgical procedure. Transthoracic ultrasonography was performed with a GE Vivid 7 ultrasound platform (GE Health Care) and a 13 MHz transducer was used to measure aortic pressure gradient and left ventricular function. Echocardiography was performed on control and Tnnt2-rtTA;Tre-Mhrt779 (Tg779) mice at designated time points after the TAC procedure. To minimize the confounding influence of different heart rates on the aortic pressure gradient and left ventricular function, the flow of isoflurane (inhalational) was adjusted to anaesthetize the mice while maintaining their heart rates at 450–550 beats per minute. The peak aortic pressure gradient was measured by continuous-wave Doppler across the aortic constriction. Left ventricular function was assessed by M-mode scanning of the left ventricular chamber, standardized by two-dimensional, short-axis views of the left ventricle at the mid papillary muscle level. Left ventricular chamber size and wall thickness were measured in at least three beats from each projection and averaged. Left ventricular internal dimensions at diastole and systole (LVIDd and LVIDs, respectively) were measured. The fractional shortening (FS) of the left ventricle was defined as 100% 3 (1 2 LVIDs/LVIDd), representing the relative change of left ventricular diameters during the cardiac cycle. The mean FS of the left ventricle was determined by the average of FS measurements of the left ventricular contraction over five beats. P values were calculated by Student’s t-test. Error bars indicate s.e.m. Histology, trichrome staining and morphometric analysis of cardiomyocytes. Histology and trichrome staining were performed as described38,39. Trichrome stain (Masson) kit (Sigma) was used and the manufacturer’s protocol was followed. For morphometric analysis of cardiomyocytes, paraffin sections of the heart were immunostained with a fluoresecin isothiocyanate-conjugated wheat germ agglutinin (WGA) antibody (F49, Biomeda) that highlighted the cell membrane of cardiomyocytes. Cellular areas outlined by WGA were determined by the number of pixels enclosed using ImageJ software (NCBI). Approximately 250 cardiomyocytes of the papillary muscle at the mid-left ventricular cavity were measured to determine the size distribution. P values were calculated by Student’s t-test. Error bars indicate s.e.m. RT–qPCR and strand-specific reverse transcription PCR analysis. RT–qPCR analyses were performed as described3,38. The following primer sequences (listed later) were used. RT–qPCR reactions were performed using SYBR green master mix (BioRad) with an Eppendorf realplex, and the primer sets were tested to be quantitative. Threshold cycles and melting curve measurements were performed with software. P values were calculated by Student’s t-test. Error bars indicate s.e.m. To conduct strand-specific RT–PCR analysis, human total RNA and Superscript III First-Strand ©2014 Macmillan Publishers Limited. All rights reserved RESEARCH LETTER Synthesis System (Invitrogen) was used. Primers R1 (Fig. 4k; CTACAGAATGAG ATCGAGGACT) and R2 (Fig. 4k; GGGGCTGAAGAGTGAGCCTT) were designed based on known sequence and were used for individual RTs, respectively. To detect MHRT, primers F1 (Fig. 4k; CTGGAGCTGGGACAGGTCAGCA) and R1 were used. These primers could also amplify endogenous MYH7 and thus serve as controls. Primers F2 (Fig. 4k; TGGGGAACACGGCGTTCTTGA) and R2 were used to specifically amplify MHRT and used in RT–qPCR analysis. PCR primers for RT–qPCR of mRNA were as follows. Mouse TfIIb-F, CTCTG TGGCGGCAGCAGCTATTT, mouse TfIIb-R,CGAGGGTAGATCAGTCTGTA GGA; mouse Hprt1-F, GCTGGTGAAAAGGACCTCT, mouse Hprt1-R, CACAG GACTAGAACACCTGC; mouse Anf-F, GACTAGGCTGCAACAGCTTCCG, mouse Anf-R, GCCACAGTGGCAATGTGACCAA; mouse Serca2a-F, CATTTG CATTGCAGTCTGGAT, mouse Serca2a-R, CTTTGCCATCCTACGAGTTCC; mouse Tnnt2-F, TACAGACTCTGATCGAGGCTCACTTC, mouse Tnnt2-R, TC ATTGCGAATACGCTGCTGCTC; mouse Mhrt-F (common), GAGCATTTGG GGATGGTATAC, mouse Mhrt-R (common), TCTGCTTCATTGCCTCTGTT T; mouse Mhrt779-F, TCTGGCCACAGCCCGCAGCTTC, mouse Mhrt779-R, AGTCATGTATACCATCCCCAA; Mouse Neat1-F, TCTCCTGGAGCCACATC TCT, mouse Neat1-R, GCTTTTCCTTAGGCCCAAAC; mouse 28S-rRNA-F, GG TAGCCAAATGCCTCGTCAT, mouse 28S-rRNA-R, CCCTTGGCTGTGGTTT CG; human TFIIB-F, ACCACCCCAATGGATGCAGACAG, human TFIIB-F, A CGGGCTAAGCGTCTGGCAC; human MHRT-F (F2), TGGGGAACACGGCG TTCTTGA, human MHRT-R (R2), GGGGCTGAAGAGTGAGCCTT; human HOTAIR-F, GGTAGAAAAAGCAACCACGAAGC, human HOTAIR-R, ACAT AAACCTCTGTCTGTGAGTGCC; human GAPDH-F, CCGGGAAACTGTGG CGTGATGG, human GAPDH-R, AGGTGGAGGAGTGGGTGTCGCTGTT. ChIP–qPCR. ChIP assay was performed as described3 with modifications. Briefly, chromatin from hearts or SW13 cells was sonicated to generate average fragment sizes of 200–600 bp, and immunoprecipitated using anti-BRG1 J1 antibody3,40, antiBrg1 H-10 antibody (Santa Cruz Biotechnology, against 115–149 amino acids of N terminus Brg1), anti-RNA polymerase II (Pol II) antibody (ab24759, Abcam), antiH3K4me3 antibody (07-473, Millipore), anti-H3K36me3 antibody (17-10032, Millipore) or normal control IgG. Isolation and purification of immunoprecipitated and input DNA were done according to the manufacturer’s protocol (Magna ChIP Protein G Magnetic Beads, Millipore), and qPCR analysis of immunoprecipitated DNA were performed. ChIP–qPCR signal of individual ChIP reactions was standardized to its own input qPCR signal or IgG ChIP signal. PCR primers (listed later) were designed to amplify the promoter regions of mouse Myh6 (2426, 2320), mouse Myh7 (2102, 158), mouse Shh (27142, 26911), mouse Vegfa (11, 1150) human GAPDH (245, 1121). The DNA positions are denoted relative to the transcriptional start site (11). PCR primers for ChIP–qPCR are as follows. Mouse ChIP-Myh6 promoter-F, GCAGATAGCCAGGGTTGAAA, mouse ChIP-Myh6 promoter-R, TGGGTAA GGGTCACCTTCTC; mouse ChIP-Myh7 promoter-F, GTGACAACAGCCCT TTCTAAAT, mouse ChIP-Myh7 promoter-R, CTCCAGCTCCCACTCCTACC; mouse ChIP-Shh promoter-F, GAGAACATTACAGGGTAGGAA, mouse ChIPShh promoter-R, GAAGCAGTGAGGTTGGTGG; mouse ChIP-Vegfa promoter-F, CAAATCCCAGAGCACAGACTC, mouse ChIP-Vegfa promoter-R, AGCGCAG AGGCTTGGGGCAGC; human ChIP-GAPDH promoter-F, TACTAGCGGTTTT ACGGGCG, human ChIP-GAPDH promoter-R, TCGAACAGGAGGAGCAGAG AGCGA. RNA immunoprecipitation. RNA immunoprecipitation (RNA-IP, RIP) was conducted as described4 with some modifications. Briefly, P1 hearts, sham hearts or those from mice that had undergone TAC, or SW13 cells were crosslinked and lysed with lysis buffer (10 mM HEPES pH 7.5, 85 mM KCl, 0.5% NP-40, 1 mM dithiothreitol (DTT), 13 protease inhibitor) for tissues or lysis buffer (10 mM Tris-HCl pH 8.1, 10 mM NaCl, 1.5 mM MgCl2, 0.5% NP-40, 1 mM DTT, 13 protease inhibitor) for cells. Nuclei were isolated and sonicated using Bioruptor (Diagenode) (30 s on, 30 s off, power setting H, 5 min, performed twice) in nuclear lysis buffer (50 mM Tris-HCl pH 8.1, 150 mM NaCl, 0.1% NP-40, 1 mM DTT, protease inhibitor, ribonuclease inhibitor). The nuclear extract was collected and incubated with primary antibodies at 4 uC overnight together with Manga ChIP Protein G Magnetic Beads (Millipore). The beads were washed by wash buffer I (20 mM Tris-Hcl pH 8.1, 150 mM NaCl, 1% Triton X-100 and 0.1% SDS) three times, and wash buffer II (20 mM Tris-Hcl pH 8.1, 500 mM NaCl, 1% Triton X-100 and 0.1% SDS) three times. Beads were then resuspended in 150 ml 150 mM RIPA (50 mM Tris pH 7.5, 150 mM NaCl, 1 mM EDTA, 0.1% SDS, 1% NP-40, 0.5% sodium deoxycholate) with 5 ml Proteinase K and incubated for 1 h at 65 uC. We added 1 ml of TRIzol to the sample, and RNA was extracted using the Quick-RNA Mini Kit with the on-column DNase I digest (ZymoResearch). RT and qPCR were then conducted with the purified RNA. The antibodies used for the immunoprecipitation are anti-BRG1 J1 antibody3,40, Ezh2 (ref. 41) (Active Motif), Suz12 (refs 41, 42) (Bethyl Laboratories) and normal IgG control. Reporter assay and truncation of the Mhrt promoter. For the Mhrt promoter reporter assay, plasmid was constructed by inserting ,2.5 kb mouse Mhrt promoter into the episomal pREP4-Luc plasmid3,19,38,43 through cloning the PCRamplified region of the promoter by using primers ACCGGCCTGAACCCCACT TCC and ATGTCGAGACAGGGAACAGAA. Mouse Myh6 (2426 to 1170, based on new genome annotation) and Myh7 (23561 to 1222) reporter constructs were described previously3. These vectors were transfected into rat neonatal cardiomyocytes or SW13 cells using lipofectamine 2000 (Invitrogen) along with plasmids expressing mouse Brg1 (actin-mBrg1-IRES-eGFP) or a matching empty vector plasmid (gifts from G. Crabtree) as well as an episomal Renilla luciferase plasmid (pREP7-RL) to normalize transfection efficiency. The transfected cells were cultured for 48 h and harvested for luciferase assay using the dual luciferase assay kit (Promega). For naked DNA reporter, mouse Myh6 promoter (2426 to 1170) was inserted in pGL3 vector (Promega), and Renilla luciferase plasmid phRL-SV40 (gifts from J. Chen) was used as a normalizer. Dual luciferase assay was performed according to the manufacturer’s instruction 48 h after transfection. For deletional analysis of the Mhrt promoter, various regions of the promoter were deleted from the full-length pREP4-Mhrt. The constructs were further analysed by transfecting into SW13 cells. RNA-EMSA and Kd calculation. Biotin-labelled RNA probe was generated by in vitro transcription with MAXIscript SP6/T7 kit (Ambion) with biotin labelling NTP mixture (Roche) using linearized pDrive-Mhrt779 construct as the template and followed by digestion with DNase I (Ambion). EMSA was performed by using the LightShift Chemiluminescent RNA EMSA Kit (Thermo Scientific). The labelled probe was incubated with appropriate amounts of recombinant proteins in 10 ml in the 13 binding buffer (10 mM HEPES-KOH, pH 7.3, 10 mM NaCl, 1 mM MgCl2, 1 mM DTT) with 5 mg tRNA carrier at room temperature for 30 min. The reactions were then loaded onto 1% 0.53 TBE agarose gel and transferred to BrightStarPlus positive charged membrane. The biotin-labelled probes were detected and quantified subsequently by IRDye 680 Streptavidin (Li-COR, 926-32231) using Odyssey Infrared Imaging System. The shifted signals were quantified and plotted against amount of the MBP, MBP–D1, MBP–D2 and MBP–D1D2 proteins using a previously described method26 with GraphPad Prism (GraphPad). The software facilitates the fitting of nonlinear regression model and calculation of Kd values based on the fitting curve. The errors and r2 values were also generated from the fitting curve. Protein expression and purification of Brg1 helicase domains. To generate MBP fusion proteins of mouse Brg1 helicase domains, the DExx-box domain (D1) (amino acids 7742913 of Brg1), helicase-C domain (D2) together with C-terminal extension (CTE) (amino acids 108621310 of Brg1), as well as the entire helicase region (D1D2) (77421310) were amplified by PCR and cloned into pMAL vector. MBP fusion proteins were induced by isopropyl-b-D-thiogalactoside (IPTG) and purified by amylose resin (E8021S, NEB). Nucleosome assembly and amylose pull-down. Nucleosome assembly was performed by using EpiMark Nucleosome Assembly Kit (E5350S, NEB) following the manufacturer’s instruction28. In brief, recombinant human core histone octamer, which consists of the 2:1 mix of histone H2A/H2B dimer and histone H3.1/H4 tetramer, were mixed with purified 5S rDNA (208 bp; N1202S, NEB), Neo (512 bp, amplified from pST18-Neo; 1175025, Roche), Myh6 core promoter (596 bp, 2426 to 1170) and Mhrt core promoter (a3/a4, 596 bp, 22290 to 21775) DNA at 2 M NaCl. PCR primers to amplify Neo are CGATGCGCTGCGAATCGGGA and CACTGA AGCGGGAAGGGACT. The salt concentration was gradually lowered by dilution to allow the formation of nucleosomes. The EMSA assay was used to assess the efficiency of nucleosome assembly. For amylose pull-down assay, the amylose resin (E8021S, NEB) was washed thoroughly and equilibrated with binding buffer (10 mM Tris-HCl, pH 7.5, 150 mM NaCl) before incubation with purified MBP or MBP–D1D2 proteins for 2 h. Nucleosome mixture or naked DNA mixture of 5S rDNA, Neo and Myh6 promoter DNA were added for incubation at 4 uC for overnight. The resin was then washed excessively by washing buffer (20 mM Tris-HCl, pH 8.1, 150 mM NaCl, 2 mM EDTA, 1% Triton X-100, 0.1% SDS) before decrosslinking and extraction of the DNA with phenol:chloroform:isoamyl alcohol. For competition assays, in vitro transcribed Mhrt779 was incubated with MBP–D1D2 in binding buffer (10 mM HEPES-KOH, pH 7.3, 10 mM NaCl, 1 mM MgCl2, 1 mM DTT) with ribonuclease inhibitor at room temperature for 30 min before adding nucleosomal DNA. The subsequent incubation, wash and DNA purification were performed as regular amylose pull-down assays. The qPCR signal of individual pulldown reaction was standardized to its own input RT–qPCR signal. qPCR primers were designed to amplify the 5S rDNA (CAAGCAAGAGCCTACGACCA; ATTC GTTGGAATTCCTCGGG), Neo (TAAAGCACGAGGAAGCGGTC; TCGACCC CAAGCGAAACAT), Myh6 promoter (GCAGATAGCCAGGGTTGAAA; TGGG TAAGGGTCACCTTCTC) and Mhrt promoter (ATGCCAAATGGTTGCTCTTT; GAGCTTGAGAACCAGGCAGT). ©2014 Macmillan Publishers Limited. All rights reserved LETTER RESEARCH Cloning of Brg1 truncation constructs. For cloning of truncated Brg1 with deletion of amino acids 7742913 (DD1) or 108621246 (DD2), primers with an NheI restriction digestion site, which complement the downstream and upstream sequences of the truncated region (DD1: CCCGGGGCTAGCCTGCAGAACA AGCTACCGGAGCT and CCCGGGGCTAGCCAGGTTGTTGTTGTACAGG GACA; DD2: CCCGGGGCTAGCATCAAGAAGTTCAAATTTCCC and CCCG GGGCTAGCCTGCAGGCCATCCTGGAGCACGAGCAG) were used to amplify from pActin-Brg1-IRES-eGFP by KOD Xtreme Hot Start DNA Polymerase (Novagen). After digestion with NheI, the linearized fragment was subject to ligation and transformation. The truncation constructs were sequenced to confirm the fidelity of the cloning. Western blot was further performed to assess the expression of the constructs. Monoclonal H-10 antibodies (Santa Cruz Biotech, sc-374197), which were raised against Brg1 N-terminal amino acids, were used in the experiments involving truncated Brg1. Protein sequence analysis. Brg1 core helicase domain (774–1202) was applied for secondary structure prediction using the Fold & Function Assignment System (FFAS) server (http://ffas.burnham.org/ffas-cgi/cgi/ffas.pl). The output revealed that Brg1 core helicase domains are structural homologues of SF2 helicases: Vasa44 (fruit fly, Protein Data Bank (PDB) accession number 2DB3), Rad54 (refs 27, 45) (zebrafish PDB accession 1Z3I, Sulfolobus solfataricus PDB accession 1Z63) and Chd1 (ref. 46) (yeast, PDB accession 3MWY). Those proteins, together with Brg1, were further employed for multiple sequence alignment with T-Coffee, which is a program allowing combination of the results obtained with several alignment methods (http://www.ebi.ac.uk/Tools/msa/tcoffee/). RNA secondary structural prediction. To predict the secondary structure for mouse Mhrt and human MHRT, the single-stranded sequence of Mhrt779 and human MHRT were analysed on the Vienna RNAfold web server (http://rna.tbi.uni vie.ac.at/cgi-bin/RNAfold.cgi) with calculation of minimum free energy29,47–49. Human heart tissue analysis. Human tissues were processed for RT–qPCR and strand-specific RT–PCR. The use of human tissues is in compliance with the regulation of Sanford/Burnham Medical Research Institute, Intermountain Medical Center, Stanford University, and Indiana University. Primary cardiomyocyte culture. For functional studies in cardiomyocytes, neonatal rat ventricular cardiomyocytes were cultured as previously described50,51. Briefly, P0 or P1 Sprague–Dawley rats were used. The ventricles were excised and trypsinized for 15 min 4–5 times. Cells were then collected and resuspended in DMEM supplements with 10% FBS. The cells were plated for 1 h to allow the attachment of noncardiomyocyte cells. The remaining cardiomyocytes were plated at a density of 2 3 105 cells ml21. The cells were transfected with Lipofectamine 2000 (Invitrogen) after 48 h. 30. Wu, B. et al. Inducible cardiomyocyte-specific gene disruption directed by the rat Tnnt2 promoter in the mouse. Genesis 48, 63–72 (2010). 31. Wei, K., Kuhnert, F. & Kuo, C. J. Recombinant adenovirus as a methodology for exploration of physiologic functions of growth factor pathways. J. Mol. Med. (Berl.) 86, 161–169 (2008). 32. Kuhnert, F. et al. Essential regulation of CNS angiogenesis by the orphan G proteincoupled receptor GPR124. Science 330, 985–989 (2010). 33. Xiong, Y. et al. Brg1 governs a positive feedback circuit in the hair follicle for tissue regeneration and repair. Dev. Cell 25, 169–181 (2013). 34. Langmead, B. & Salzberg, S. L. Fast gapped-read alignment with Bowtie 2. Nature Methods 9, 357–359 (2012). 35. Li, H. et al. The Sequence Alignment/Map format and SAMtools. Bioinformatics 25, 2078–2079 (2009). 36. Quinlan, A. R. & Hall, I. M. BEDTools: a flexible suite of utilities for comparing genomic features. Bioinformatics 26, 841–842 (2010). 37. Trapnell, C. et al. Differential gene and transcript expression analysis of RNA-seq experiments with TopHat and Cufflinks. Nature Protocols 7, 562–578 (2012). 38. Stankunas, K. et al. Endocardial Brg1 represses ADAMTS1 to maintain the microenvironment for myocardial morphogenesis. Dev. Cell 14, 298–311 (2008). 39. Chang, C. P. et al. A field of myocardial-endocardial NFAT signaling underlies heart valve morphogenesis. Cell 118, 649–663 (2004). 40. Khavari, P. A., Peterson, C. L., Tamkun, J. W., Mendel, D. B. & Crabtree, G. R. BRG1 contains a conserved domain of the SWI2/SNF2 family necessary for normal mitotic growth and transcription. Nature 366, 170–174 (1993). 41. Grote, P. et al. The tissue-specific lncRNA Fendrr is an essential regulator of heart and body wall development in the mouse. Dev. Cell 24, 206–214 (2013). 42. Klattenhoff, C. A. et al. Braveheart, a long noncoding RNA required for cardiovascular lineage commitment. Cell 152, 570–583 (2013). 43. van der Vlag, J., den Blaauwen, J. L., Sewalt, R. G., van Driel, R. & Otte, A. P. Transcriptional repression mediated by polycomb group proteins and other chromatin-associated repressors is selectively blocked by insulators. J. Biol. Chem. 275, 697–704 (2000). 44. Sengoku, T., Nureki, O., Nakamura, A., Kobayashi, S. & Yokoyama, S. Structural basis for RNA unwinding by the DEAD-box protein Drosophila Vasa. Cell 125, 287–300 (2006). 45. Thomä, N. H. et al. Structure of the SWI2/SNF2 chromatin-remodeling domain of eukaryotic Rad54. Nature Struct. Mol. Biol. 12, 350–356 (2005). 46. Hauk, G., McKnight, J. N., Nodelman, I. M. & Bowman, G. D. The chromodomains of the Chd1 chromatin remodeler regulate DNA access to the ATPase motor. Mol. Cell 39, 711–723 (2010). 47. Zuker, M. & Stiegler, P. Optimal computer folding of large RNA sequences using thermodynamics and auxiliary information. Nucleic Acids Res. 9, 133–148 (1981). 48. Gruber, A. R., Lorenz, R., Bernhart, S. H., Neubock, R. & Hofacker, I. L. The Vienna RNA websuite. Nucleic Acids Res. 36, W70–W74 (2008). 49. Wan, Y., Kertesz, M., Spitale, R. C., Segal, E. & Chang, H. Y. Understanding the transcriptome through RNA structure. Nature Rev. Genet. 12, 641–655 (2011). 50. Fu, X. M., Yao, Y. J., Yang, Z., Xiang, L. & Gao, J. [Alteration and its significance to expression of aquaporin-4 in cultured neonatal rat astrocytes in the model of hypoxic damage.] Sichuan Da Xue Xue Bao Yi Xue Ban 36, 641–644 (2005). 51. Yang, J. et al. C-reactive protein augments hypoxia-induced apoptosis through mitochondrion-dependent pathway in cardiac myocytes. Mol. Cell. Biochem. 310, 215–226 (2008). ©2014 Macmillan Publishers Limited. All rights reserved RESEARCH LETTER Extended Data Figure 1 | Mhrt RNAs have no coding potential. a, RNA in situ analysis of Mhrt (blue) in a mouse E12 heart. The RNA probe targets all Mhrt species. Red: nuclear fast red. Black arrowheads indicate nuclei of endothelial, endocardial or epicardial cells. Inset shows magnified region from the boxed area. endo, endocardium; epi, epicardium; IVS, interventricular septum; LV, left ventricle; RA and RV, right atrium and ventricle, respectively. Scale bars 5 100 mm. b, Codon substitution frequency (CSF) scores of TfIIb and Hprt1 mRNA, as well as full-length Mhrt species. c, In vitro translation of control Mhrt species (709, 779, 826, 828, 857, 1147) and luciferase (Luc). Arrow points to the protein product of luciferase. d, Biotin-labelling of Mhrt species (709, 779, 826, 828, 857, 1147) and luciferase in the in vitro translation reactions. Arrow points to the RNA product of luciferase. e, Ribosome profiling relative to whole transcriptome RNA sequencing. x-axis: genomic position at the human GAPDH and the murine Myh7 loci. y-axis: mapped reads. f, Scatter plot of RNA in fragments per kilobase per million reads (FPKM). Noncoding RNAs (purple) cluster towards the x-axis; coding RNAs (orange) towards the y-axis. Mhrt779 is found below both the identity line (dashed, slope 5 1, intercept 5 0) and the smooth-fit regression line (in blue). RNA examples are endogenous except that HOTAIR was co-transfected with Mhrt779. ©2014 Macmillan Publishers Limited. All rights reserved LETTER RESEARCH Extended Data Figure 2 | Quantification of Myh6/Myh7, northern blot, and Mhrt779 characterization. a, Quantification of cardiac Myh6/Myh7 ratio 2–42 days after sham or TAC operation. b, Northern blot analysis of Mhrt, Myh6 and Myh7. Negative: control RNA from 293T cells. Size control: 826 is recombinant Mhrt826; 643 (not a distinct Mhrt species) contains the 59 common region of Mhrt. Heart: adult heart ventricles. c, Un-cropped northern blots of Mhrt, Myh6 and Myh7. d, RNA in situ hybridization of Mhrt779 of adult heart ventricles. White arrowheads indicate nuclei of myocardial cells. Black arrowheads indicate nuclei of endothelial, endocardial or epicardial cells. Blue: Mhrt779; Red: nuclear fast red. Epi, epicardium. The dashed line separates the epicardium from myocardium. Scale bars 5 50 mm. e, Quantification of TfIIb, Hprt1, 28S rRNA, Neat1 and Mhrt779 in the nuclear and cytoplasmic fraction of adult heart ventricle extracts. The nuclear/ cytoplasmic ratio of TfIIb is set as 1. P values: Student’s t-test. Error bars show s.e.m. ©2014 Macmillan Publishers Limited. All rights reserved RESEARCH LETTER Extended Data Figure 3 | Wheat germ agglutinin staining, time course and molecular marker studies of the stressed Tg779 mice. a, Wheat germ agglutinin (WGA) immunostaining 6 weeks after the sham or TAC operation. Green: WGA stain, outlining cell borders of cardiomyocytes. Blue: 49,6diamidino-2-phenylindole (DAPI). Ctrl, control mice. Scale bars 5 50 mm. b, Time course of fractional shortening (FS) in control and Tg779 mice. c, Quantification of Anf, Bnp, Serca2 and Tgfb1 in control and Tg779 mice 2 weeks after sham or TAC operation. d, Experimental design for treatment study and time course of left ventricular fractional shortening changes. e, Fractional shortening of the left ventricle (LV) 8 weeks after the operation. f, Ventricular weight/body weight ratio of hearts harvested 8 weeks after sham or TAC operation. P values: Student’s t-test. Error bars show s.e.m. ©2014 Macmillan Publishers Limited. All rights reserved LETTER RESEARCH Extended Data Figure 4 | Regulation of the Mhrt promoter. a, Sequence alignment of Mhrt promoter loci from mouse, human and rat. Peak heights indicate degree of sequence homology. Black boxes (a1–a4) are sequences of high homology, which were used for further ChIP analysis. Green box region between Myh6 and Mhrt is the putative Mhrt promoter. Red, promoter regions; salmon, introns; yellow, untranslated regions. b–d, ChIP–qPCR analysis of Mhrt promoter using antibodies against Pol II (b), H3K4me3 (c), and H3K36me3 (d) in tissues of adult mice. e, RT–qPCR quantification of Mhrt in control and Brg1-null hearts after 7 days of TAC. Ctrl, control. Brg1-null, Tnnt2-rtTA;Tre-Cre;Brg1fl/fl. f, Luciferase reporter assay of Mhrt promoter in SW13 cells. Ctrl: dimethylsulphoxide (DMSO). PJ-34, PARP inhibitor; TSA, trichostatin (HDAC inhibitor). g, ChIP analysis of BRG1, HDAC2, HDAC9 and PARP1 in SW13 cells. The cells were transfected with episomal Mhrt promoter cloned in pREP4. h, Deletional analyses of the Mhrt promoter in luciferase reporter assays in SW13 cells. Luciferase activity of full-length Mhrt promoter was set up as 1. P values: Student’s t-test. Error bars show s.e.m. ©2014 Macmillan Publishers Limited. All rights reserved RESEARCH LETTER Extended Data Figure 5 | Mhrt does not affect Myh expression by direct RNA sequence interference. a, qPCR analysis of Mhrt779, Myh6 and Myh7 in mice without TAC operation. Expression levels were normalized to TfIIb, and the control is set as 1. Ctrl, control mice. b, c, RNA quantification of Mhrt (b) and HOTAIR (c) in SW13 cells transfected with Vector (pAdd2), HOTAIR (pAdd2-HOTAIR) or Mhrt (pAdd2-Mhrt779). Expression in vectortransfected cells is set as 1. Constructs containing Myh6 or Myh7 were co-transfected into SW13 cells used for Fig. 2b–i. d, e, RNA quantification of Myh6 (d) and Myh7 (e) in SW13 cells relative to GAPDH. f, g, Western blot analysis of Myh6 (f) and Myh7 (g) in SW13 cells. Constructs containing Myh6- and Myh7-coding sequences were tagged with Flag and co-transfected with vector, HOTAIR or Mhrt779. GAPDH was used as the loading control. Flag–D1 was used as a positive control for the Flag antibody. h, i, Protein quantification of Myh6 (h) and Myh7 (i) in control and transfected SW13 cells relative to GAPDH. Signals of Myh6 and Myh7 from major bands or the entire lanes were quantified.WB, western blot. j, Luciferase reporter assay of Mhy6 and Myh7 promoters in SW13 cells transfected with vector (pAdd2) or Mhrt (pAdd2-Mhrt779). P values: Student’s t-test. Error bars show s.e.m. ©2014 Macmillan Publishers Limited. All rights reserved LETTER RESEARCH Extended Data Figure 6 | RNA-IP controls; Opn is another target gene of Brg1 in stressed hearts. a, Immunostaining of Brg1 in P1 heart. Red: Brg1. Green: WGA. Blue: DAPI. Ctrl, control. Scale bar 5 50 mm. b, RNA-IP of Mhrt in P1 hearts using antibodies against Ezh2 and Suz12. Right panels show immunostaining of Ezh2 and Suz12 in P1 hearts. PRC2, polycomb repressor complex 2. Red: Ezh2 or Suz12. Green: WGA. Blue: DAPI. Scale bars 5 50 mm. c, Quantification of Opn mRNA in control and Brg1-null (Tnnt2-rtTA;TreCre;Brg1fl/fl) mice after sham or TAC operation. d, ChIP of Brg1 on Opn proximal promoter in control and transgenic (Tg779) mice after sham or TAC operation. e, Quantification of Opn in control and transgenic (Tg779) mice after sham or TAC operation. P values: Student’s t-test. Error bars show s.e.m. ©2014 Macmillan Publishers Limited. All rights reserved RESEARCH LETTER Extended Data Figure 7 | Induction of Mhrt779 is insufficient to change Brg1 mRNA or protein level. a, qPCR analysis of Brg1 expression in hearts without TAC operation. Ctrl: control mice. b–e, Immunostaining of Brg1 (red) in adult heart ventricles 2 weeks after sham or TAC operation. Green: WGA. Blue: DAPI. Scale bars 5 50 mm. f, Western blot analysis of Brg1 and Coomassie staining of total proteins in control or Tg779 hearts after 2 weeks of sham or TAC operation. g, Quantification of Myh6 and Myh7 in control (Ctrl) and Tg779 hearts after 2 weeks of sham or TAC operation. P values: Student’s t-test. Error bars show s.e.m. ©2014 Macmillan Publishers Limited. All rights reserved LETTER RESEARCH Extended Data Figure 8 | Brg1 sequence alignment and motif analysis. Schematics of the architecture of mouse Brg1 and the sequence alignment of Brg1, Vasa (fruit fly), Rad54 (zebrafish, Sulfolobus solfataricus) and Chd1 (yeast). The motifs were outlined by blue boxes (D1 domain) and purple boxes (D2 domain). ©2014 Macmillan Publishers Limited. All rights reserved RESEARCH LETTER Extended Data Figure 9 | Purification of Brg1 helicase core domains, EMSA of naked Myh6 promoter, ChIP and reporter studies in SW13 cells. a, Coomassie blue staining of purified MBP-tagged Brg1 helicase domains. Bovine serum albumin (BSA) was loaded as a control. b, EMSA assay of naked Myh6 promoter (2426 to 1170) with helicase domains of Brg1. Probe: biotin-labelled Myh6 promoter. 50 mM of MBP, MBP–D1, MBP–D2 and MBP– D1D2 proteins were used for EMSA. c, d, ChIP (c) and luciferase reporter (d) analysis of Brg1 on chromatinized (episomal) and naked Myh6 promoter in SW13 cells. GFP, green fluorescent protein control. e, The luciferase reporter of helicase-deficient Brg1 on chromatinized (episomal) Myh6 promoter in SW13 cells. DD1: Brg1 lacking amino acids 774–913. DD2: Brg1 lacking amino acids 1086–1246. ChIP: H-10 antibody recognizing N terminus, nondisrupted region of Brg1. P values: Student’s t-test. Error bars show s.e.m. ©2014 Macmillan Publishers Limited. All rights reserved LETTER RESEARCH Extended Data Figure 10 | Brg1 outruns Mhrt to bind to its target Mhrt promoter. a, Assembly of nucleosomes on the Mhrt promoter (a3/4). b, Amylose pull-down assay: amylose was used to pull down the chromatinized Mhrt promoter that was incubated with various doses of MBP and MBP–Brg1 D1D2. DNA precipitated by amylose was further quantified by qPCR. P values: Student’s t-test. Error bars show s.e.m. ©2014 Macmillan Publishers Limited. All rights reserved RESEARCH LETTER Extended Data Figure 11 | Sequence alignment and secondary structure prediction of human and mouse MHRT, and demography of heart transplantation donors. a, Sequence alignment of human MHRT and mouse Mhrt779. b, Predicted secondary structure of mouse Mhrt779 and human MHRT, using minimal free energy (MFE) calculation of RNAfold WebServer. c, Demography of human subjects whose tissues were used for RT–qPCR analysis (Fig. 4l). ICM, ischaemic cardiomyopathy; IDCM, idiopathic cardiomyopathy; LVH, left ventricular hypertrophy. ©2014 Macmillan Publishers Limited. All rights reserved
Biol 547 Fall 18 Scientific Paper Summary #6 (Han et al.) Identify the major goal of the authors in this paper and explain why this project is important. Explain the figure 1 in terms of the experimental design and the results How does the figure 1 fit into the bigger project of the paper? Explain. What is the next experiment authors focus on after the publication of this paper? Why? What is a Zinc Finger Protein and what is its function?

Tutor Answer

mariam90
School: Cornell University

The paper is complete...

flag Report DMCA
Review

Anonymous
Top quality work from this guy! I'll be back!

Similar Questions
Hot Questions
Related Tags

Brown University





1271 Tutors

California Institute of Technology




2131 Tutors

Carnegie Mellon University




982 Tutors

Columbia University





1256 Tutors

Dartmouth University





2113 Tutors

Emory University





2279 Tutors

Harvard University





599 Tutors

Massachusetts Institute of Technology



2319 Tutors

New York University





1645 Tutors

Notre Dam University





1911 Tutors

Oklahoma University





2122 Tutors

Pennsylvania State University





932 Tutors

Princeton University





1211 Tutors

Stanford University





983 Tutors

University of California





1282 Tutors

Oxford University





123 Tutors

Yale University





2325 Tutors