Need biology help to Make a worksheet about Protein

Dec 18th, 2015
Anonymous
Category:
Science
Price: $10 USD

Question description

Show the steps taken by an eukaryotic cell to make a protein. Below is a section of the non-template strand of the DNA containing the gene that codes for our desired protein. 

NT: ATAATGCGCATTGGACACACTTGA

1. Write the complementary template strand

2. Transcribe the DNA to RNA using the template strand

3. Where in the cell would transcription take place? 

4. If the RNA produced is mRNA, where in the cell does it go next?

5. To what organelle does it connect with there?

6. Translate the mRNA you obtained in #2 into proteins using the genetic code table shown below.

7. What are proteins consisted of?  


Tutor Answer

(Top Tutor) TRENDINOVA
School: UIUC
PREMIUM TUTOR

Studypool has helped 1,244,100 students

Review from student
Anonymous
" Awesome! Exactly what I wanted. "
Ask your homework questions. Receive quality answers!

Type your question here (or upload an image)

1821 tutors are online

Brown University





1271 Tutors

California Institute of Technology




2131 Tutors

Carnegie Mellon University




982 Tutors

Columbia University





1256 Tutors

Dartmouth University





2113 Tutors

Emory University





2279 Tutors

Harvard University





599 Tutors

Massachusetts Institute of Technology



2319 Tutors

New York University





1645 Tutors

Notre Dam University





1911 Tutors

Oklahoma University





2122 Tutors

Pennsylvania State University





932 Tutors

Princeton University





1211 Tutors

Stanford University





983 Tutors

University of California





1282 Tutors

Oxford University





123 Tutors

Yale University





2325 Tutors