San Diego University Umbrella Corporation Nucleotide Sequence Information Worksheet

User Generated

Nyonnfuvxv

Science

San Diego State University

Description

Homework #2:

Premise: There has been a shipwreck. The cause of the shipwreck is unknown because nobody survived the incident. Upon investigation, samples of a powdery substance as well as blood samples were discovered in a mysterious box aboard the ship.

Each lab member will be assigned a sample set which includes the sequencing results from the powdery substance (“sequence 1”) and the blood sample (“sequence 2”). You are responsible for analyzing your assigned nucleotide sequences.

Each student will independently fill out a “Confidential Researcher Report Form” from the company that hired them in investigate the accident. They will describe in detail their findings about their assigned sequences and, ultimately, have to draw a conclusion about how all the passengers died using the analysis of the blood sample and what they found in their independent research.

  • Please make sure you are working on your assigned sample set:
    • Find which sample set you’re assigned to on Canvas under the “People” section then click on the “Groups” tab.
  • Open NCBI BLAST website: https://blast.ncbi.nlm.nih.gov/Blast.cgi?PAGE_TYPE=BlastSearch
  • Copy the first sequence from your sample set and paste it into the BLAST query field.
  • Click “BLAST”
  • Refer to the "Confidential Researcher Report Form" to know what key features to investigate.
  • Explore the features of BLAST to find as much information as you can.
  • Repeat for the second sequence in your sample set.

Sequences

Sample Set 1Sequence 1: ggcgcacagctgctcgcgcgccgcctccagggccgccggcgacttccaggcgcccccgcgcactcgcccgaagcgcacccacacctcgtcccactcggccgcggcggcctccagcgagcgccgcagggcggtcgtccggcggcacgcctcgccgagcgcgtccaggcgcccgtgcagccgcgcgagggggtcgggggcgccgtcgcgcgcggcggtcagcgatggagttcccctttgggtccgtgggaactaccaacttcagacggttcactccagagtcgctggcagagatcgagaagcagatcgctgcccaccgcgccgccaagaagggcagacctaagcaaagaggacagaaggacaagagtgagaagcccaggcctcagttggacttgaaggcctgtaaccagctgcccaggttctatggcgagctcccagcagagctggtcggggagcccctggaggacctggatcctttctacagcacacaccggacattcatagtgttggataaaagcaggaccatttccagattcagtgccacttgggctctgtggctcttcagtcccSequence 2: acattctccttcttatagactcaggaagcaatcatggtgctctctgcagatgacaaaaccaacatcaagaactgctgggggaagattggtggccatggtggtgaatatggcgaggaggccctacagaggtgagatcaggaccctgttctttaaggacagcaggatccaaaccggaccagggactcagtgggcagctcctaagtgtgctttcccgtggcctcaacttatctctccttctcacaggatgtt

using these information you need to fill out this paper that I uploaded.

Unformatted Attachment Preview

1 Confidential Researcher Report Form T-57-666 The Umbrella Corporation is not responsible for any damages, personal injury, or death that results from contract work on this project. You are required to sign the non-disclosure form X556 (Safety acknowledgement form) and refrain from discussing your work on this project outside of your task force group indefinitely. Failure to comply will result in the application of penalties described in form X-556, including but not limited to: fines not to exceed $500,000, imprisonment, and possible termination of physical existence. Sec. 1: Nucleotide Sequence Information Gene name or names (best match - list percent identity and e-value) Gene product (protein, enzyme, miRNA, etc.) Biological relevance Relevance to incident being investigated for this report Sec. 2: Blood Sample Information Genetic Constituent(s) Organism Identity or Identities Biological relevance Confidential Researcher Report Form T-57-666 Page 1 of 2 2 Relevance to incident being investigated for this report Sec. 3: Incident Assessment Primary causative agent Hypothesized method of action for causative agent Potential long-term environmental hazards Potential long-term human health hazards I hereby certify that this report is my own independent assessment of this incident and is accurate to the best of my knowledge: Signature:___________________________________Group:___________ Date:___________ Confidential Researcher Report Form T-57-666 Page 2 of 2
Purchase answer to see full attachment
User generated content is uploaded by users for the purposes of learning and should be used following Studypool's honor code & terms of service.

Explanation & Answer

Please let me know if you need any revisions on it. Thanks

1

Confidential Researcher Report Form T-57-666
The Umbrella Corporation is not responsible for any damages, personal injury, or death that
results from contract work on this project. You are required to sign the non-disclosure form X556 (Safety acknowledgement form) and refrain from discussing your work on this project
outside of your task force group indefinitely. Failure to comply will result in the application of
penalties described in form X-556, including but not limited to: fines not to exceed $500,000,
imprisonment, and possible termination of physical existence.
Sec. 1: Nucleotide Sequence Information
Gene name or names (best match - list percent identity and e-value)
Gene name: sodium channel, voltage-gated, type X, alpha {Mus musculus (house mouse)}
Percent Identity: 100%
e-value: 4e-179
Gene name: Synthetic construct Mus musculus clone IMAGE:100063029, MGC:191007 sodium
channel, voltage-gated, type X, alpha (Scn10a) mRNA, encodes complete protein
Percent Identity: 100%
e-value: 1e-178
Gene product (protein, enzyme, miRNA, etc.)
Protein
Biological relevance
Sodium Voltage-Gated Channel Alpha is a Protein Coding gene. Diseases associated with this
gene include Episodic Pain Syndrome, Familial, 2 and Sodium Channelopathy-Related Small
Fiber Neuropathy. Voltage-gated sodium channels are responsible for action potential initiation
and propagation in excitable cells, including nerve, muscle, and neuroendocrine cell types.
The SCN1A gene encodes a NAV 1.1 voltage-led alpha subunit in the sodium channel. This
mutation has proved to be the etiology behind many primary epilepsy experiments including
febrile pathogens. Primary epilepsy is an epilepsy which cannot have a clear origin, such as
stroke, brain paralysis or other causes.

Relevance to incident being investigated for this report
Sodium voltage dysfunction has correlations with neurological and heart disease, including
epilepsy, myopathies and heart rhythms. Dysfunction, including secondary toxins, may be
genetically modified or acquired. The toxins of marine animals are mainly used to block sodium
voltage-gated ...


Anonymous
Really helped me to better understand my coursework. Super recommended.

Studypool
4.7
Trustpilot
4.5
Sitejabber
4.4

Related Tags