I. DNA & RNA wed! A. The chemicals found in DNA and RNA are very similar. Review the table below. DNA Deoxyribose RNA Ribose Sugars Phosphate Present Present Bases Adenine Guanine Cytosine Thymine Adenine Guanine Cytosine Uracil B. Fill in the chart below: Molecule In DNA or RNA or Both? Deoxyribose Ribose Phosphate Uracil Thymine Both RN Both RNA DNA Both Both Both Cytosine Guanine Adenine 1. How many sugars are present in DNA? In RNA? 2. How many kinds of bases are present in DNA?_4 In RNA? 5 3. A phosphate group, sugar and nitrogen base can collectively be called a 4. Using the chart, what are 2 ways in which DNA differs from RNA? and 5. DNA and RNA differ in one other way not mentioned in the chart. What is it? ORD and follo DUNIA 6. Nitrogen bases can be classified as either purines or pyrmidines. Which bases are purines? and Which are pyrimidines? and 7. Since uracil takes the place of thymine in RNA, do you think it is a pyrmidine or a purine? 8. Is DNA a polymer? Explain: 9. A nucleotide like ATP contains 3 phosphate groups. The nucleotides in DNA only contain 1 phosphate group. What happens to the other 2 phosphate groups? How & when are they used? II. DNA Structure 1. What kind of bonds form between the nitrogen bases in a DNA strand? 2. Are these bonds strong or weak? Why does that make sense? 3. What is the name of the bond that forms between the phosphate groups and the sugar groups? 4. Are the above bonds strong or weak? Why does that make sense? 5. Are the sides of the DNA molecule hydrophobic or hydrophilic? Why would that be important for the molecule? 6.Is the inside of the DNA molecule hydrophobic or hydrophilic? Why would this be important for the molecule? 7. This lab does not show DNA's antiparallel characteristic. Please explain below what antiparallel means: ORDER ONLINE and follore your order with DOMINUS TRACKER What does 5 represent? 9. What does 3 represent? Ill. DNA REPLICATION 1. What enzyme is needed to break the hydrogen bonds and unwind the DNA molecule? 2. What enzyme is needed to relieve the strain head of the twisting DNA molecule? 3. What proteins attach to the single stranded DNA to prevent 2 strands from reannealing? 4. The actual point where DNA replication begins is called: 5. Once the strands are separated, the origin forms a: 6. The enzyme that adds DNA nucleotides to the new strand is called: 7. How does the enzyme from #6 know where to start adding nucleotides? 8. Is the above answer made up of DNA or RNA nucleotides? 9. The enzyme that forms the starting point from #7 is called: 10. The enzyme in #6 can only add DNA nucleotides in a certain direction. Explain: 11. The short fragments formed along the lagging strand are called: 12.How are these short fragments eventually joined together? 13. Below is a sequence of DNA bases along one side of a DNA strand. Please add the correct complimentary nucleotides, including the correct hydrogen bonding (2 or 3 bonds) --A---T---C---A---A---G---T---A---G---C---G---T---A---A---C---G---A---G- IV. TRANSCRIPTION 1. Where does transcription take place? 2. What enzyme is responsible for adding the RNA nucleotides to the DNA strand? 3. How does the enzyme in #2 know where to bind on the DNA strand to start transcription? WUN 4. There are proteins that help the enzyme in #2 bind to #3. These are called: 5. When transcription is complete, the sequence that is read is called: 6. The sequence in #5 codes for an mRNA strand that reads: and would read in DNA 7. If the DNA code is CTGATAGAT then the mRNA strand would be: 8. If the DNA code is TCAGCTGAAT then the mRNA strand would be: 9. If the mRNA strand reads AUACCGAUU then the DNA code is: V. TRANSLATION · 1. What is the name of the bond that joins 2 or more amino acids join together? 2. Where does translation take place? 3. Name the 3 bindings sites in the large ribosomal unit: and 5. The complementary triplet code found on a tRNA molecule is called: 6. The enzymes that links tRNA to its specific amino acid are called 7. If a DNA code reads TACCAATGTGTGCAA then the mRNA strand would be: and the tRNA's anticodons would be: and the amino acid sequence would be: 8. If a tRNA anticodon sequence reads UACGCGAAAAUC then the mRNA strand would be: and the amino acid sequence would read Fill in: CDNA DNA TACCCCGGATAACGCCATACT mRNA TRNA aa
Purchase answer to see full attachment