Form #: 2 Cell Bio Lab Final Exam: Part II Instruc ons Sheet Please use the informa on in this Instruc ons Sheet, that you have been uniquely assigned, to complete your Final Exam Part II Answer Sheet. Be sure to record your Name, Lab sec on, and Form # on your answer sheet word doc (available for download in the assignment instruc ons in Canvas). Work on your own and be sure short answer wri en responses are all typed and paraphrased in your own words to receive credit. (40pt) 1. Did we use SDS-PAGE to purify or verify puri ca on of our recombinant DHFR protein? Explain your answer. (3pt) 2. Imagine we were to use an an -His tag primary an body for our Western Blot analysis. Based on the data your lab sec on obtained this semester, indicate your expected results by comple ng the chart below: (3pt) an -His Sample Number of bands Size of each band (kDa) *GST-DHFR-His His-tagged DHFR Myc-Flag-tagged DHFR lysate Control lysate *Which speci c data obtained provided ra onale for your above expected result for our GST-DHFR-His sample and why? List and brie y explain all that apply. (2pt) 3. We an cipate our recombinant DHFR protein to be func onal for use in future research applica ons. However, if you had been able to test func onality and found that your recombinant GST-DHFR-His protein was not func onal, what would you propose is one poten al issue you would inves gate to troubleshoot further. In other words, what is one thing that could have gone wrong to result in non-func onal protein from the method used and results obtained this semester? Please be speci c with the issue, where in the procedure it would have occurred, and explain your ra onale. (4pt) 4. Use the DHFR fusion protein nucleo de sequence provided below. Hint: the DHFR fusion protein sequence you have been provided with here only contains one tag. a. Which reading frame (5’3’) did you use to translate the sequence: 1, 2, or 3? _______ (2pt) b. Where is the tag located: At the N-terminus or C-terminus of DHFR? ____________ (2pt) ti ti ti ti fi ti ti ti ti ti ti ti ti fi ti ti ti ti ti ti fl ti tt fi ti ti ti fl ti c. Brie y describe how you found the tag loca on in (b.) above. (2pt) d. What is the tag used: Myc, FLAG, GST, or His? _____________ (2pt) e. What is the calculated molecular weight of this fusion protein? __________kDa (2pt) DHFR fusion protein nucleo de sequence: ATGGTTGGTTCGCTAAACTGCATCGTCGCTGTGTCCCAGAACATGGGCATCGGCAAGAACGGGGACCTGCCCTGGCCACCGCTCAGGAA TGAATTCAGATATTTCCAGAGAATGACCACAACCTCTTCAGTAGAAGGTAAACAGAATCTGGTGATTATGGGTAAGAAGACCTGGTTCTCC ATTCCTGAGAAGAATCGACCTTTAAAGGGTAGAATTAATTTAGTTCTCAGCAGAGAACTCAAGGAACCTCCACAAGGAGCTCATTTTCTTT CCAGAAGTCTAGATGATGCCTTAAAACTTACTGAACAACCAGAATTAGCAAATAAAGTAGACATGGTCTGGATAGTTGGTGGCAGTTCTGT TTATAAGGAAGCCATGAATCACCCAGGCCATCTTAAACTATTTGTGACAAGGATCATGCAAGACTTTGAAAGTGACACGTTTTTTCCAGAA ATTGATTTGGAGAAATATAAACTTCTGCCAGAATACCCAGGTGTTCTCTCTGATGTCCAGGAGGAGAAAGGCATTAAGTACAAATTTGAAG TATATGAGAAGAATGATCATCACCATCACCATCACTAA 5. Once you have expressed and puri ed your DHFR fusion protein from the sequence provided above, you want to determine the concentra on of the puri ed protein sample for further analysis. Use the following informa on to answer ques on parts a-d below: Standard curve equa on: y = 0.0024x + 0.018 Dilu on of puri ed protein sample: 1:5 Absorbance value of protein dilu on: 0.474 (can assume this value is within range of the curve) a. What is the concentra on of the dilu on analyzed? ________ug/mL (2pt) b. What is the concentra on of your original (undiluted) sample? ________ug/mL (2pt) c. Convert your protein concentra on above in (b.) from ug/mL to ug/uL: ________ug/uL (1pt) d. Complete the following table to prep your DHFR fusion protein sample for SDS-PAGE. You are looking to load 15ug in a total volume of 40uL. (3pt) Protein Concentra on (ug/uL) From (c.) above Concentra on of sample + 2X Laemmli (ug/uL) (Bringing Laemmli to 1X) Volume (uL) of sample+Laemmli mix needed for 15ug Volume (uL) of 1X Laemmli solu on to bring total vol to 40ul ti fi ti ti fi ti ti ti ti ti ti ti ti fi ti ti ti ti ti ti 6. Imagine you produce, purify, and analyze this DHFR fusion protein from ques on 4 & 5 above by Western Blot using an an -DHFR primary an body. You obtain the following unexpected result: There is no band present from your DHFR fusion protein sample nor is there a band present from the puri ed His-tagged DHFR control sample. Would any of the following errors likely explain this unexpected result? Yes or No and why for each? (6pt) a. The transfer apparatus was connected to the wrong electrodes (electrical current was provided in the wrong direc on) and proteins did not transfer onto the nitrocellulose membrane b. You accidentally added an an -FLAG an body instead of an an -DHFR an body at the primary an body incuba on step c. You forgot to perform the wash steps during puri ca on, so your DHFR sample was contaminated with other proteins. 7. When screening for new DHFR inhibitor molecules to treat bacterial infec ons, do you want the molecule to speci cally target prokaryo c DHFR, eukaryo c DHFR, or both? Brie y explain your ra onale. (2pt) 8. Which Labster simula on (Molecular Cloning, Protein Synthesis, Signal Transduc on, ELISA) do you feel was most helpful to your understanding of our recombinant DHFR project procedures and why? (2pt) fi ti ti ti ti ti fl ti ti fi ti ti ti ti ti ti ti fi ti (For a reminder of the content and skills covered in each, you can visit the Simula on page summary for each in the Week 2, 3, 7, and 10 Canvas modules.) Molecular cloning simulation About this Learning Simulation Molecular cloning is one of the techniques that has laid the foundation for modern biotechnology. The technique was first used in the 1980′s and allowed the insertion of an insulin gene derived from humans to be inserted into yeast and coli bacteria. This allowed the microbes to produce insulin, which is the primary medication in diabetes treatment. Since then, molecular cloning and genetic engineering has become one of the most fundamental techniques ranging from pharmaceutical production, bioethanol production along with medical to basic research. In the Molecular Cloning lab, you will learn how to assemble an expression vector containing RAD52 and GFP. The aim is to control the expression level of RAD52 with Doxycyline and to monitor the expression level by observing the GFP signal. Vector assembly In the first part of the Molecular Cloning lab, you will learn how to extract DNA from yeast cells and restrict enzyme isolation in DNA from another vector. First, you will prepare the extracted DNA and measure the concentration, and then, you will assemble a vector containing a gene of interest (RAD52) and GFP using the correct ligase, buffer and temperature of incubation. Transformation The assembled vector will be transformed into yeast cells using electroporation. RAD52 gene expression is regulated by a gene regulator. When Doxycyline is added to the media, RAD52 gene will be silenced. GFP is used as a reporter gene to RAD52, cells with active RAD52 will also express GFP and cells with silenced RAD52 will not express GFP. The GFP signal is monitored by exposing the cells to blue light. DNA damage and repair system RAD52 is hypothesized to be an important player in DNA repair. You will perform an experiment comparing the result of induced DNA damage through UV radiation in cells expressing RAD52 and cells with silenced RAD52. If RAD52 is important in performing DNA repair, cells with silenced RAD52 will not survive the UV radiation treatment. All in all, the Molecular Cloning lab will give you an overview of the molecular cloning techniques and the reporter gene, and you will learn all about DNA damage and DNA repair system. Protein Synthesis Simulation About this Learning Simulation In the Protein Synthesis lab, you will learn about the difference between protein synthesis in prokaryote (using E. coli) and eukaryote (using CHO cells). Prepare recombinant Erythropoietin and use the mass spectrometer Your first task in the lab will be to prepare recombinant Erythropoietin that is transfected into E. coli and CHO cells. The lab assistant will prepare the recombinant EPO and you will measure the mass to charge ratio using a mass spectrometer. Not sure how to handle the mass spectrometer? No worries! You can just take out your labpad and find an animated video to learn the basics. Study the translation process from mRNA to amino acids You will also learn about the translation process from mRNA to amino acids and how amino acids are assembled to proteins. A 3D animation is shown describing how triplets of codons are translated into amino acids, how these amino acids are joined together by peptide bonds creating a primary structure of protein, and furthermore, how the primary structure is folded into secondary, tertiary and quaternary structure. Investigate doping in bike athletes In the last part of the Protein Synthesis lab, you will use mass spectrometry and investigate if there are any athletes who are using rhEPO as a doping substance. You will do so by collaborating with the doping agent who collects urine samples in a large bicycle race. Will you be able to detect if any of the athletes are using doping? Simulation: Signal Transduction About this Learning Simulation In this simulation, you will learn how tumor cells send signals to surrounding cells to help promote tumor growth, and how this signal is transmitted inside the cell. Analyze patient samples by western blotting As a researcher in the R&D department of a big pharma company, your mission will be to test the hypothesis that increased blood vessel growth, also called angiogenesis, plays a role in breast cancer development. To investigate this idea, you will perform a western blot experiment to test for the expression of vascular endothelial growth factor receptor (VEGFR) expression in patient samples compared to healthy tissue samples. Learn about VEGFR signal transduction Following the interpretation of initial results, you will learn more about how VEGFR, a receptor tyrosine kinase (RTK) transmits an external signal to the inside of the cell, and how this influences angiogenesis. You will be able to follow the process in a 3D animation. Develop a strategy for breast cancer therapy Finally, your mission is to test different inhibitors targeting VEGFR signaling. You will design an experimental approach to test for the activity of this specific class of RTKs. Will you be able to identify a promising new drug candidate for treating patients with breast cancer? Simulation: ELISA About this Learning Simulation Trying to capture a specific protein amongst thousands of types of proteins is like looking for a needle in a haystack. In the ELISA simulation, you will join scientists who are using a groundbreaking technique for detecting and quantifying substances, such as protein. The method is called Enzyme-linked immunosorbent assay (ELISA). You will help Dr. Lisa quantify Factor IX protein, which is used for hemophilia drugs. Detecting Factor IX In the simulation, Dr. Lisa is working on producing protein used for treating hemophilia patients. The protein is called Factor IX. She produces them in different cell lines. However, she needs your help to determine which cell lines produce Factor IX the most. To help Dr. Lisa, you will perform an ELISA technique. Performing ELISA Scientists have developed numerous kinds of ELISA. You will learn the principles of the most common ELISA method. ELISA is about antibody and antigen, which you should already be familiar with. Once you understand the principle of each type of ELISA, you will have to decide which ELISA technique you want to use. Analyzing the results Not all experiments run smoothly. In this simulation, you will compare good and bad results. By comparing the results, you will be able to perform basic troubleshooting for your results. Finally, you will interpolate your data to find out which cell lines are producing Factor IX the most. Will you be able to help Dr. Lisa in reducing the production cost of hemophilia drug? SDS-PAGE Gel Code Blue and Western Blot analysis Data Images See well labels, order of sample loading may vary Gel code blue staining of SDS-PAGE gel Western Blots Anti-DHFR Anti-rabbit alkaline phosphatase secondary antibody was used + NBT substrate for detection Anti-GST Anti-Myc Anti-Tubulin Production of Recombinant Dihydrofolate Reductase Cell Biology Lab Manual PCB 3023L Department of Cell Biology, Microbiology and Molecular Biology University of South Florida, Tampa Spring 2021 Adapted from the Protein Expression and Purification Series, Courtesy of Bio-Rad Laboratories, Inc., © 2011. Table of contents Recombinant Protein Expression and Purification Cell and Plasmid Selection for Protein Expression Protein Purification and Quantification SDS-PAGE and Western Blot Computational Sequence Analysis Page 1 8 10 23 31 Protein Expression and Purification Series Recombinant Protein Expression and Purification Why Produce Proteins Recombinantly? To be used for research, industrial or pharmaceutical purposes, proteins need to be purified in large quantities. Some proteins, like casein, which makes up 20% of the protein content in milk, can easily be extracted from a readily available source in large quantities. However, most proteins are not naturally produced in a form and in amounts that allow easy purification. The techniques of genetic engineering overcome the limitations of naturally produced proteins by making cells synthesize specific proteins in amounts which can be purified for use in fundamental research or for industrial and therapeutic applications. Biogen, one of the first companies to develop recombinant proteins, is using genetic engineering to produce human interferon beta-1a in Chinese hamster ovary (CHO) cells and is sold under the tradename Avonex. A similar form of recombinant human interferon, interferon beta-1b, is expressed in E. coli and sold by Bayer under the drug name of Betaseron. (An interferon is an immune protein produced in response to a virus, bacteria, parasite, or tumor cell.) Both recombinant human interferon beta-1a and 1b have been developed, tested, and brought to the market to help slow the progression of multiple sclerosis. Without recombinant production of these proteins in CHO cells or in E. coli, there would not be an easy way to obtain this protein for therapeutic usage. Table 5.1 Human proteins produced by genetic engineering. Human proteins produced via genetic engineering and the disease or disorder they are used to treat. Protein Used in the treatment of Insulin Diabetes Somatostatin Growth disorders Somatrotropin Growth disorders Factor VIII Hemophilia Factor IX Christmas disease Interferon-alpha Leukemia and other cancers, MS Interferon-beta Cancer, AIDS, MS Interferon-gamma Cancers, rheumatoid arthritis Interleukins Cancers, immune disorders Granulocyte colony stimulating factor Cancers Tumor necrosis factor Cancers Epidermal growth factor Ulcers Fibroblast growth factor Ulcers Erythropoietin Anemia Tissue plasminogen activator Heart attack Superoxide dismutase Free radical damage in kidney transplants Lung surfactant protein Respiratory distress alpha 1-antitrypsin Emphysema Serum albumin Used as a plasma supplement Relaxin Used to aid childbirth 1 Protein Expression and Purification Series Choice of Cell Type The biotechnology industry uses several cell types, both prokaryotic (bacteria) and eukaryotic (animal, fungi, plant), to synthesize recombinant proteins. The choice of the host cell depends on the protein expressed. Bacteria can express large amounts of recombinant protein, but the expressed proteins sometimes do not fold properly. In addition, bacterial cells cannot carry out the post-translation modifications that are characteristic of some of the proteins made by eukaryotic cells. The most important post-translation modification is glycosylation, the covalent addition of sugar residues to the amino acid residues making up the protein. Glycosylation can change the structure and thus affect the activity of a protein. Many mammalian blood proteins are glycosylated, and the addition of these sugars often changes the rate of turnover (half-life) of the protein in the blood, because proteins that are misfolded will be quickly degraded. If glycosylation is important for the function of the protein, mammalian cells are the cell type of choice, but these cells produce less protein and are more expensive to grow. In the early days of the biotechnology industry Escherichia coli (E. coli) was the bacterial host of choice. This species had been used as the primary experimental system to study bacterial genetics for decades. More was known about the molecular biology of E. coli than any other species, and many genetic variants were available. In addition E. coli grows quickly, can reach high cell concentrations, and can produce large quantities of a single protein. It is also relatively inexpensive to grow. Today E. coli remains the bacterial system of choice, and many companies produce recombinant proteins using this bacterial species. Insulin, the first protein produced by genetic engineering, was produced in E. coli. Blockbuster products like human growth hormone and granulocyte colony stimulating factor (which increases white cell production in cancer chemotherapy patients) are also produced using this bacterial species. In general, if a protein’s properties allow it to be produced in bacteria, then E. coli is the system of choice. For recombinant protein expression in lower eukaryotic cells, two yeast species are commonly used: Saccharomyces cerevisiae (S. cerevisiae) and Pichia pastoris (P. pastoris). S. cerevisiae is the yeast species used to make bread, wine and beer. Baker’s yeast is used in research laboratories as a model system to study the genetics of eukaryotic cells. P. pastoris is a yeast species initially discovered by the petroleum industry. It divides rapidly, grows to a very high cell density, and can produce large quantities of a single protein. In addition, it can be genetically engineered to secrete the protein into the surrounding medium to allow easier recovery. Both species can glycosylate proteins, although the glycosylation patterns may differ from mammalian patterns. The sugars that are added to the protein and their position on the amino acid chain may differ between yeast and mammalian cells. Despite these advantages, relatively few biotech companies use yeast as a production system. The exceptions are the vaccine that immunizes against hepatitis B virus and the vaccine Guardasil that immunizes against HPV, the human papillomavirus. If a protein has a very large and complex structure, or if that protein requires glycosylation to be active, then the protein must be produced in a mammalian cell line. Chinese hamster ovary cells (CHO) is the cell line that is almost always used. CHO cells bear relatively little resemblance to the cells of the hamster from which they were derived in the 1950s; they have adapted to growth in cell culture medium. Cell lines are established when cells from a multicellular organism are separated from one another by a protein-digesting enzyme and grown as if they are really a unicellular organism. The cells require a rich medium that provides them with all of the amino acids, vitamins, and growth factors that they need to grow. This complexity means that mammalian growth medium is many times more expensive than the media used to grow either bacterial or yeast cells. The CHO cell lines can be adapted for growth in suspension culture. The CHO cell lines are most often engineered to synthesize the protein of interest on the ribosomes 2 Protein Expression and Purification Series attached to the rough endoplasmic reticulum, to package and glycosylate the protein in the Golgi apparatus, and to eventually secrete the protein into the extracellular medium where it is easier to purify. CHO cells can glycosylate proteins with a mammalian glycosylation pattern. If glycosylation is important to the function of the protein, CHO cells should be used. Because CHO cells divide slowly, the production runs are much longer than with E. coli (on the order of weeks rather than days). All equipment and all growth media must be scrupulously sterilized. A single contaminating bacterial cell will overgrow the culture and will lead to that batch being discarded. Although the growth of CHO cells takes longer, uses expensive media, and presents a greater risk of contamination, the isolation of the proteins that these cells produce is usually easier than in bacterial or yeast cells. Interferon beta provides a good example of how the end product influences the choice of expression system for recombinant proteins. Avonex, the human interferon beta-1a form produced in CHO cells, is glycosylated; while Betaseron, the human interferon beta-1b form produced in E. coli, is not glycosylated. Since glycosylation is important for interferon beta-1a function, it is produced in CHO cells. Table 5.2 Advantages and disadvantages of using bacteria, yeast and mammalian cells to produce recombinant proteins. Parameter Bacteria Yeast Contamination risk Low Low Mammalia n High Cost of growth medium Low Low High Product titer (concentration) High High Low Folding Sometimes Probably Yes Glycosylation No Yes, but different pattern Full Relative ease to grow Easy Easy Difficult Relative ease of recovery Difficult Easy Easy Deposition of product Intracellular Intracellular or extracellular Extracellular Product Intracellular Often secreted into media Secreted Table 5.3 Examples of pharmaceutical products and the cell line used to produce them. Product Cell Line Insulin Escherichia coli Human growth hormone Escherichia coli Granulocyte colony stimulating factor Escherichia coli Tissue plaminogen activator CHO cells Pulmozyme (DNase) cystic fibrosis CHO cells Erythropoietin induces red blood cell production CHO cells Hepatitus B virus vaccine Yeast Human papillomavirus vaccine Yeast Rituxan rheumatoid arthritis, non-hodgkins lymphoma, leukemia CHO cells Herceptin breast cancer CHO cells Choice of Plasmid Once the cell type has been chosen, the plasmid or vector to express the protein needs to be selected. Different plasmids are used for expression of proteins in bacteria, yeast and higher 3 Protein Expression and Purification Series eukaryotic cells. Some features that need to be considered in the plasmid include: selection system (such as antibiotic resistance), the promoter, the copy number of the plasmid, presence of signal peptide sequence to excrete the expressed protein out of the cell, presence of sequence coding for a protein purification tag or DNA coding for fusion protein partners. Antibiotic resistance is a common component of both prokaryotic and eukaryotic vector systems. The presence of a gene for antibiotic resistance allows for selective retention of the plasmid and suppression of growth of any cells that do not contain the plasmid. However, to ensure safety for expression systems being used for vaccine and therapeutic protein production, other selection systems can be used such as the expression of a required metabolic enzyme that has otherwise been deleted from the host organism. The promoter controls the level of gene expression. It can be either constitutive, meaning that it is always active and there is no control over when the protein of interest is expressed, or inducible, meaning that its activity can be triggered by external factors. Examples of inducible promoters are the heat shock promoters, which are activated by a change in temperature. These promoters are derived from naturally occurring sequences in organisms that need to express a different protein when they are in a warm environment versus a cold one. Other inducible promoters are activated by the addition of a chemical such as lactose or its analog IPTG in the case for the LacZ promoter in E. coli. The T7 promoter is an example of a chemically induced promoter system. For industrial applications, genes for the protein of interest tend to be under inducible control. The copy number of a plasmid depends on the origin of replication present in the plasmid. The origin of replication determines the level of control of replication of the plasmid, and if the plasmid is under a relaxed control more copies can be made. The size of the plasmid and size of the insert also affect the number of copies. If there are more copies of the plasmid in cells it is possible for them to produce more protein than cells that have fewer copies of the plasmid. Plasmids used for cloning such as pUC tend to be higher copy number while plasmids used for protein expression tend to be larger and have lower copy number. Prokaryotic Cells Eukaryotic Cells Bacterial/Yeast Culture Cell Culture Cell Lysis and Protein Extraction To facilitate the purification of the expressed protein, DNA sequences coding for a signal (amino acid sequence) that targets the protein of interest to be secreted into the periplasmic region of E. coli or into the extracellular medium for eukaryotic cells, can be fused to the gene of interest. Other tags that are commonly added are fusion proteins to increase the solubility of the expressed protein (such as glutathione-SFigure 5.1 Gene Design For Recombinant Protein Production. 4 Protein Expression and Purification Series transferase, GST) or affinity tags (polyhistidine or GST tags) that can be used to selectively purify the recombinant protein. Choice of Cell Expression System Once the cell expression system has been determined for recombinant protein production, the gene construct to express the recombinant protein needs to be designed. This could be as simple as taking the coding sequence of the gene of interest as it exists in the parent organism and inserting this sequence into an expression plasmid for the cell system being used. However, this usually does not produce optimal levels of recombinant protein when the gene is expressed in a heterologous system (a cell or organism different from the one where the gene is naturally found) because the preferred codon usage for various species differs. For example, the codon GGA for glycine can be found at a frequency of 16.4 times per 1000 codons in human genes while it is only used 9.5 times per 1000 codons in E. coli genes. Therefore, there is a chance that leaving this codon in the recombinant gene might lead to lower levels of recombinant expression due to a scarcity of tRNA molecules for GGA. A second consideration for recombinant gene design is whether or not the protein of interest is expressed in a soluble or in an insoluble form. If a protein is expressed in an insoluble form, it can be easier to initially separate it from components, such as nucleic acids, phospholipids and soluble proteins, by centrifugation. An insoluble protein is also relatively protected from the action of proteolytic proteins that are present in the host cell that can be released upon lysis of the cell. However, if a fully functional recombinant protein is desired, it is necessary to refold the insoluble protein to its native conformation, which many times proves extremely problematic especially if the fully refolded protein has disulfide bonds and multiple subunits. The ability to express a recombinant protein in the soluble form is partially dependent on the protein being expressed as well as the rate of expression of the recombinant protein. If the protein is expressed at an extremely high rate, it could overwhelm the native proteins involved in folding proteins (such as chaperonins) in the cell host. The rate of expression can be controlled by the promoter system involved such as the T7 polymerase system used commonly in E. coli. A final consideration for recombinant protein gene design is how the recombinant protein will be purified from the other host cell components. Some recombinant proteins, such as antibodies, have a specific antigen against which they were raised and hence can be purified by binding to that molecule (affinity chromatography).* Other recombinant proteins have a very large positive or negative charge associated with them and can be purified by binding to charged resins (ion exchange chromatography). Some proteins do not have any strong distinguishing property, and an affinity tag, such as GST or a histidine tag can be added as a DNA sequence to the gene of interest at either the 5' or 3' end of the recombinant gene. The tag attached to the protein enables the specific purification of the recombinant protein using affinity chromatography methods. *Antibodies can also be purified by binding to Protein A, a surface protein of Staphylococcus aureus which has high affinity for immunoglobulins. Protein A is commonly used for the first step in the purification of antibodies in industrial applications. DHFR—Our Protein of Interest The focus in the experiment here is on the protein dihydrofolate reductase (DHFR), which is essential for proper cell function and illustrates the importance of basic oxidation– reduction enzymatic reactions. DHFR is an enzyme that converts 5 Protein Expression and Purification Series dihydrofolate, a folic acid derivative, into tetrahydrofolate (THF) by the addition of a hydride from NADPH. Tetrahydrofolate is a methyl group shuttle required for the synthesis of purines, thymidylic acid, and amino acids, all essential for nucleic acids. DHFR is ubiquitous in prokaryotic and eukaryotic cells, and is found on chromosome 5 in humans. Deficiency in DHFR has been linked to megaloblastic anemia, an anemia disorder with larger-thannormal red blood cells, as well as cerebral folate metabolism disorders. Both are treatable with folic acid and/or Vitamin B12, depending on symptoms. Being able to control DHFR makes it a powerful tool not only for research and gene manipulation but also for medical treatments for cancer and malaria. When DHFR is inhibited or reduced, it leads to a shortage of thymidylates, interfering with nucleic acid synthesis. A lack of nucleic acid synthesis thus interferes with cell growth, proliferation, and ultimately causes cell death. DHFR Cancer Connection Cancer occurs when a particular cell loses the ability to control its division. These dividing cells spread, displace normal cells, disrupt the architecture of tissues, and use up the nutrients required by normal cells. Surgery can remove most of the cells in a solid tumor, but malignant cancers send out colonizing cells called metastases that use the blood and lymph systems to spread far from the tumor and non-solid tumors, such as leukemia or lymphoma, are not confined to one specific area. Clinicians use radiation or chemotherapy to kill these cells. Figure 5.2 DHFR protein structure. Chemotherapy drugs target cancer cells by disrupting the functions of actively dividing cells. This strategy exploits the fact that most of the cells in an adult are not dividing. Therefore, chemotherapy damages the rapidly dividing cancer cells by disrupting structures required for mitosis, like spindle fibers, or by disrupting the production of nucleotides required for DNA replication. One of the first chemotherapeutic agents was methotrexate, a folic acid analog that interferes with folic acid metabolism. Treatment with methotrexate limits the ability of dividing cells to make nucleotides by competitively inhibiting the enzyme dihydrofolate reductase (DHFR). When the enzyme DHFR is inhibited, cancer cells cannot divide and spread. Occasionally after repeated treatments with methotrexate, a patient’s cancer will develop a methotrexate resistance and will stop responding to the drug. Some of these resistant cells when examined show that the resistance was due to an increased copy number of DHFR genes. This gene amplification leads to increased levels of DHFR protein in the cell and therefore an increased ability to catalyze its reaction and produce nucleotides, even in the presence of methotrexate. DHFR and Malaria DHFR is also integral to parasite cell metabolism. Malaria is caused by the parasite Plasmodium falciparum, which is transmitted to humans by mosquitoes. Once in the human bloodstream, the parasite multiplies, eventually causing headaches, fever, coma, and ultimately, death if untreated. 6 Protein Expression and Purification Series Like in humans, interrupting the DHFR pathway in Plasmodium leads to reduced DNA synthesis: blocking DHFR successfully blocks Plasmodium falciparum multiplication. There are many drugs to treat malaria, but drug-resistant strains are becoming more and more common. Strains resistant to the once effective DHFR inhibitors pyrimethamine, sulphadoxine, and methotrexate are appearing. Having a system to produce recombinant DHFR to study its enzymatic activity and develop inhibitors for chemotherapy or antimalarial drugs could be a powerful tool in developing new therapeutics. Scientists continue to search for effective drugs to stop the spread of malaria and cure those infected with malaria. Use of DHFR in Biomanufacturing The regulation of the DHFR gene amplification phenomenon described above is used to produce genetically engineered CHO cells to biomanufacture particular therapeutic proteins. Cells containing the gene of interest and DHFR are treated with methotrexate leading to the amplification of the DHFR gene; since the gene of interest lies next to the DHFR gene, the transgene is amplified too. This increases the amount of protein produced by the cells. Individual clones are separated and independently tested for their ability to produce protein and to divide. A particular clone that produces a large amount of protein and that retains its ability to divide quickly, will become the master cell bank from which all subsequent cells for production runs will be pulled. 7 Cell and Plasmid Selection for Protein Expression Recombinant Production of DHFR Cell Selection In this series of laboratory exercises, you will express the human DHFR gene in E. coli, a recombinant protein host system that is used extensively for research and industrial purposes. The bacteria have a quick doubling time (20 minutes) and are easy and inexpensive to culture, induce, and lyse to release cell contents. Also, posttranslational modifications such as phosphorylation and glycosylation are not required for the human DHFR to function properly, also making E. coli a good selection. Plasmid Selection A high level of expression with tight regulation is desired so the pET21a plasmid system will be used. This plasmid contains the constitutively expressed β-lactamase gene that confers resistance to ampicillin. The pET21a vector used contains the T7 promoter. This vector is used with a specific type of E. coli, the BL21(DE3) strain. This strain has been engineered to contain the T7 RNA polymerase gene (a gene that is not endogenous to bacteria) placed under the control of the inducible lac promoter. Addition of lactose or its analog IPTG to the growth medium, will induce the expression of the T7 RNA polymerase and, thus, the expression of any gene placed downstream of the T7 promoter. In the absence of the inducer, there is no expression of the gene. Figures 1.3.a (above) and 1.3.b (below). Protein expression control using the pDHFR plasmid in a BL21(DE3) E. coli. 8 Protein Expression and Purification Series Figure 1.3a shows the use of the pDHFR plasmid in BL21(DE3) E. coli having tightly controlled expression of GST-DHFR-His. Both the BL21(DE3) E. coli genomic DNA and the pDHFR plasmid contain the lac I gene which codes for the lac repressor protein. Both the BL21(DE3) E. coli genomic DNA and the pDHFR plasmid also have recombinant genes that are inserted after a lac operon site. In the BL21(DE3) E. coli genomic DNA, the inserted gene codes for bacteriophage T7 RNA polymerase. In the pDHFR plasmid, the inserted gene codes for the fusion protein GST-DHFR-His. Before the lac operon, the BL21(DE3) E. coli genomic DNA has a native E. coli RNA polymerase promoter site. This is different than on the pDHFR plasmid where before the lac operon, there is a bacteriophage T7 RNA polymerase promoter site. The lac repressor protein is constitutively expressed, and when there is no lactose or its analog IPTG present, the lac repressor protein binds to the lac operon on both the genomic and plasmid DNA, preventing binding of the appropriate RNA polymerase and transcription of genes downstream from the lac operons, T7 RNA polymerase and GST-DHFR-His, respectively. Figure 1.3b shows that once lactose or its analog IPTG has been added, the lac repressor protein detaches from the lac operon on both the genomic DNA and the pDHFR plasmid. This allows binding of the constitutively expressed E. coli RNA polymerase to the E. coli RNA polymerase promoter site on the genomic DNA and starts the transcription of the bacteriophage T7 RNA polymerase gene. Once the bacteriophage T7 RNA polymerase gene has been transcribed and translated into protein, the bacteriophage T7 RNA polymerase binds to the promoter region on the pDHFR gene. Once bound, the bacteriophage T7 RNA polymerase transcribes the recombinant gene GST-DHFR-His coded for on the pDHFR plasmid. Gene Design When expressed in E. coli using the pET21a system, the human DHFR is insoluble. To increase its solubility, a GST tag was added to its N-terminus. A six histidine sequence (polyhistidine tag) was added to the C-terminus of DHFR to allow for easy purification by metal affinity chromatography. The resulting plasmid codes for a GST-DHFR-His fusion protein that can be expressed in E. coli BL21(DE3). Culturing E. coli for Protein Expression Logarithm of viable cells The starting point in the Protein Expression and Purification Series is lyophylized BL21(DE3) E. coli containing pDHFR which will be rehydrated and plated to generate individual colonies. An initial culture is grown to saturation from a single bacterial colony picked from a Petri dish. This culture is used to initiate a larger culture that is grown to mid-log phase at which stage expression of the recombinant protein is induced by addition of IPTG to the medium. Determining when cells have reached their mid-log phase of growth is accomplished by measuring the absorbance of the culture at 600 nm. An OD600 of 0.6–1.0 is the typical target for induction. At this point the cells are dividing rapidly, and production of the protein will be optimal. Figure 1.4. Depiction of cell growth phase in relation to overall culture viability. 9 For the GST-DHFR-His construct in the BL21(DE3) E. coli an overnight culture containing 1% glucose is grown from a single colony on an LB/amp plate. The 1% glucose is added to ensure that the lac operon remains repressed and no T7 RNA polymerase or GST-DHFR-His is expressed. Leaky expression (not actively induced) of recombinant proteins is generally undesirable because expression of the recombinant protein may be toxic and prevent bacterial growth. The overnight culture (late log/stationary phase) is diluted in fresh LB medium and allowed to grow until mid-late log phase. At mid-log phase, expression of GST-DHFR-HIS is induced by addition of IPTG. Cells will use their internal Protein Expression and Purification Series biochemistry to produce the recombinant protein and will not divide as quickly or at all. After induction has been completed, cells are recovered by centrifugation, and protein is extracted from the cell pellet. Protein Purification and Quantification Introduction to Protein Purification Protein purification is an important step in biotechnology workflows. It is the isolation of the protein of interest so that it may be used in subsequent research, for diagnostic tests, or for pharmaceutical production. The purity needed depends on its end use. For proteins used in research 90–95% purity may be sufficient but for proteins used for pharmaceutical applications, much higher purity levels (up to 99.99%) must be reached. How purification is done will depend on the type of protein engineered, the volume of protein to be purified, the degree of purity required, and the availability of special laboratory equipment. The first step in the purification workflow is to extract the protein from the cells by lysing, or breaking them open. Techniques used for lysing cells depend on what type of cell—bacterial, plant, or mammalian—was used to produce the protein as well as where the protein is produced in the cell. Freeze-thaw cycles, enzymatic digestion, chemical breakdown, and mechanical disruption methods such as sonication or grinding (mortar and pestle) are some of the cell lysis techniques available. In this laboratory the E. coli cells are lysed in a buffer containing lysozyme, an enzyme which digests the cell wall, along with freeze-thaw cycles. Once the cells are lysed, the soluble and insoluble components are separated by centrifugation. The insoluble components form a pellet at the bottom of the tube while soluble components will remain in the aqueous phase. (Not only proteins are found in the cell lysate, but also nucleic acids, sugars, phospholipids and other cell components.) When present in high concentration, nucleic acids (mostly genomic DNA) render the aqueous phase viscous making it difficult to isolate the recombinant protein. To reduce viscosity the genomic DNA can be broken down using sonication (ultrasound), a French Press that shears the DNA by pushing the cell lysate through a narrow opening at very high pressure or shearing the lysate using a narrow gauge syringe needle. These treatments break the genomic DNA down into small fragments and reduce viscosity. The DNA can also be degraded enzymatically by addition of a DNase. A too viscous soluble fraction of protein can be problematic since it may clog the resin and the frit (bed support) of the chromatography column during the subsequent protein purification step. Isolating the Recombinant Protein of Interest Proteins are usually purified by chromatography. There are a variety of chromatographic methods to choose from; the method used will depend on the protein’s physicochemical properties. In the following sections some of the common chromatographic techniques available are described. Introduction to Protein Chromatography Chromatography is commonly used in biotechnology for separating biological molecules, such as proteins, from complex mixtures. Chromatography consists of a mobile phase (solvent and the molecules to be separated) and a stationary phase, such as paper (in paper chromatography) or glass, resin, or ceramic beads (in column chromatography), through which the mobile phase travels. The stationary phase is typically packed in a cylinder known as a column. Molecules travel through the stationary phase at different rates or bind to the solid phase based on their physicochemical properties. The liquid used to dissolve the biomolecules to make the mobile phase is usually called a buffer. In column chromatography the mixture of biomolecules dissolved in the buffer is called the sample. The sample is allowed to flow through the column bed, and the biomolecules within the buffer enter the top of the column bed, filter through and around the beads, and ultimately pass through a small opening at the bottom of the column. For this process to be completed additional buffer is placed on the column bed after the sample has entered the bed. The mobile phase liquid is collected, as drops, into collection tubes that are sequentially ordered. A set number of drops, known as a fraction, is collected into each tube. Fractions are collected so that they may later be analyzed to see which one or ones contain the protein or proteins of interest. 10 Protein Expression and Purification Series Chromatography Techniques There are many ways to perform liquid column chromatography. The choice of chromatography media and buffers depends on the properties of the protein of interest to be purified. Hydrophobic Interaction Chromatography (HIC) separates molecules based on their hydrophobicity. Hydrophobic (water-fearing) substances do not mix well with water. Exposing a hydrophobic protein to a high salt buffer causes the three-dimensional structure of the protein to change so that the hydrophobic regions of the protein are more exposed on the surface of the protein and the hydrophilic (water-loving) regions are more shielded. The sample in high salt buffer is then loaded onto a chromatography column packed with hydrophobic interaction beads. The hydrophobic proteins in the sample will stick to the beads in the column. The more hydrophobic the proteins are, the more tightly they will stick. When the salt is removed by flowing in a low salt buffer through the column, the three-dimensional structure of the protein changes again so that the hydrophobic regions of the protein now move to the interior of the Figure 1.5. Depiction of HIC separation of molecules based on protein, and the hydrophilic regions move to the exterior. The result is that hydrophobicity. the hydrophobic proteins no longer stick to the beads and elute (wash out) from the column, separated from the other proteins. Size ExclusionChromatography(SEC), also known as gel filtration or desalting chromatography, separates molecules based on their shape and size. The solid phase is made of gel beads that have pores of varying size (think of them like wiffle balls). Larger molecules cannot enter the pores and are excluded, so they merely flow between the beads and are eluted first. Smaller molecules can enter the pores and therefore will take longer to flow down the column. Typically, size exclusion columns are tall, narrow columns so that there is a long path for the molecules to flow through or to be retained by the pores and better separated from each other. Size exclusion chromatography can also be used to exchange the buffer that the molecule of interest is currently in for another buffer. IonExchangeChromatography(IEX) beads have either a positive (cation) or negative (anion) charge. During ion exchange chromatography, the protein of interest binds to Figure 1.6. SEC separation of molecules based on size. 1) A mixture of large and small proteins is applied to a column of porous beads. 2) As the buffer flows down the column, the small proteins penetrate into the beads and are slowed. 3) The larger protein molecules emerge from the column first. the oppositely charged beads. If the charge of the beads is positive, it will bind negatively charged, or anionic, molecules. This technique is called anion exchange (AEX) chromatography. If the beads are negatively charged, they bind positively charged, or cationic, molecules, called cation exchange (CEX). A scientist picks the resin based on the charge of the protein of interest. After contaminants are separated from the protein of interest, a high salt buffer is used to disrupt the interaction and to elute the protein of interest from the column. Resin Type Net Charge of Molecule of Interest Charge of Resin Anion Exchanger Cation Exchanger - + + - For example, in anion exchange chromatography, the resin beads have a molecule with a positive charge covalently attached to the resin. The molecules to be separated flow across the resin beads and any positively charged molecules are repelled and do not stick to the column, exiting the column with the flow of the buffer. Negatively charged molecules will bind, or adsorb, to the column. The column is then washed with buffer of increasing salt concentration, and those molecules that are more tightly bound will elute. Cation exchange chromatography works in a comparable way except that the resin beads have molecules with negative charges covalently bound to them. 11 Protein Expression and Purification Series In ion exchange chromatography knowing the isoelectric point (pI) of the protein allows researchers to manipulate the charge of the protein. The pI of the protein is where the protein has equal positive and negative charges. A buffer with pH higher than the pI will give the protein a negative charge; a buffer with pH below the pI of the protein will have a more positive charge. This change of charge depending on buffer pH can be used to elute protein from ion exchange columns by changing buffer pH. Mixed Mode, orMultimodal, Chromatography resins combine more than one type of chromatography technique, such as having both anion and cation exchange properties on the same bead. Based upon the properties of the molecule of interest and the buffers used, this can be a very selective chromatography method. In AffinityChromatography(AC), a ligand with specific affinity for the molecule to be isolated is covalently attached to the beads. A mixture of proteins is added to the column and everything passes through except the protein of interest which binds to the ligand and is retained on the solid support. The desired molecule is primarily eluted by adding a molecule that competes for the ligand. The affinity chromatography methodology depends on the presence of a specific tag on the recombinant protein such as a polyhistidine (His) affinity tag; a fusion protein partner, such as maltose binding protein or glutathione-s-transferase (GST-tag), or an antibodyantigen interaction such as protein A or protein G and different classes of antibodies. Polyhistidine-tagged proteins bind to nickel groups that have been attached to the resin, known as immobilized metal affinity chromatography (IMAC). The histidine groups of the polyhistidine-tag bind to the Ni++ groups on the resin. The protein of interest can be eluted by the addition of imidazole which competes for nickel binding sites. A second example is using a fusion partner such as GST. This protein will bind to a resin bead coated with glutathione. In order to elute the recombinant protein fused with GST, glutathione is added to the mobile phase and competes with the binding site on the GST and the fusion protein elutes. Figure 1.7. Depiction of the interaction of the Ni++ groups on the resin and the polyhistidine tag. In this laboratory purification affinity polyhistidine tag chromatography (more specifically, immobilized metal affinity chromatography (IMAC)), will be used to purify DHFR. The recombinant DHFR in this laboratory also has a GST-tag, but in this instance the tag was added to make the protein more soluble and increase the overall molecular weight of the fusion protein. It would be possible to use the GST-tag in a second round of purification. In research and industrial purification of proteins more than one chromatographic method is needed to reach the level of purity desired. Chromatography Methods Once the chromatographic purification strategy is chosen for the target protein, a decision needs to be made as to how the chromatographic separation will be performed. Batch Purification The simplest way to perform chromatography is in a beaker. To do this, the chromatography resin of choice is resuspended in buffer in a beaker. The sample is added. The beaker is either gently swirled to mix the sample and resin, or a stir bar and stir plate may be used, being careful not to damage the resin. Next, the resin is allowed to settle, the buffer is decanted and wash buffer is added to the beaker. Again, the resin is mixed, and the buffer is decanted. Finally, an elution buffer is added and the decanted buffer is saved since that is where the protein of interest should be. This method may work well for purifying crude extracts where quantity, and perhaps quality, of protein is not a concern. 12 Protein Expression and Purification Series GravityChromatography The most common way to purify protein is by column chromatography using gravity flow. In gravity chromatography the resin is resuspended in buffer and poured into a column. The column is placed upright in a stand and the resin is allowed to settle into what is known as the resin bed. Once the resin has settled, the sample is loaded onto the column. As the sample flows through the column, buffer is added to the column so that the top of the resin bed stays wet and there is a pressure head to continuously push the sample and buffers through the resin. The buffer and sample rely on gravity to move through the column. During the Figure 1.8. Gravity column set-up chromatography process fractions are collected. Samples from these fractions are tested for purity and for the presence of the protein of interest. The main advantage of gravity chromatography is that it is an inexpensive method of purification. A glass or plastic column, buffers, sample, a column holder, and test tubes to collect the fractions are all that is needed. Columns, and sometimes resin, can be cleaned and reused multiple times. The expense of this method of chromatography is time. A person must monitor the column so that it does not go dry, ensure the correct buffers are used when they should be used, and collect fractions. Gravity chromatography is typically used with larger diameter chromatography beads and softer resins. There needs to be minimal resistance to flow due to gravity or this will not work. (Think of trying to flow water through a small diameter of sand versus around pebbles or rocks.) Spin Column Chromatography A variation on gravity chromatography is the use of a spin column. Spin columns are typically small (3–5 cm in length) plastic chromatography columns that fit in a standard microcentrifuge. They come empty or in many cases prepacked with resin. The sample volume that can be applied to the column is limited by the small size of the column and by how much protein can bind to the amount of resin in the tube; the advantage, however, is that this is a quick way to perform chromatography. Simply load the resin or add buffer to a prepacked column, spin in the centrifuge, add sample in buffer, spin again to bind the protein, add elution buffer, and spin again. The gravitational force from the spin “pulls” the buffer and sample through the column. The spin column fits in a centrifuge tube, and after each spin the column is moved to a fresh tube so at the final spin the protein of Figure 1.9. Spin column interest will be in the elution tube. Each resin or prepacked column has a spin protocol to follow on how to use it in a spin column and how fast to spin it. (See Appendix C for more information on centrifuge spin speed.) The advantage of the spin column is that it is quick and relatively inexpensive in terms of columns, resin, and time. Many spin columns come prepacked with popular resins. Most spin columns are single use. They require a centrifuge and sometimes require a certain rotor (the inside of the centrifuge, where the tubes are placed), that will depend on the length of the spin column and type of chromatography resin used. Prepacked Chromatography Cartridges Figure 1.10. Prepacked chromatography cartridge. Prepacked cartridges are a good choice for chromatographic needs when sample size is too large for a spin column, but a short purification time is desired. Cartridges are convenient as they are prepacked with resin, consistent in quality of resin bed from column to column, and disposable. Most cartridges have Luer-Lok or similar screw-like connections that allow them to be used with a syringe with a 13 Protein Expression and Purification Series Luer-Lok end, a mechanical pump or chromatography system. The simplest way to use a prepacked cartridge is with a Luer-Lok syringe. The syringe is used to deliver the buffers and sample in sequence and collect the eluate or fractions in test tubes. For more complex purifications or for a hands-off approach, a pump can be used to deliver the sample and buffers through the columns. Some monitoring of the pump may be needed depending on the programming capabilities. The cartridge can also be connected to a fraction collection system or apparatus. ChromatographySystems Most large-scale purifications, when the sample volume is milliliters to liters and columns range in size from smaller than a tube of toothpaste to 100 L and larger, are performed using a chromatography system. The system will allow for multiple buffers and columns to be used. Systems can range from low pressure to high pressure, and basic to complex. As the complexity of the chromatography equipment rises, so does the price. The decision of which system to use depends on the purification scheme. Figure 1.11. Bio-Rad BioLogic System. Purification of our recombinant protein of interest Chromatographic purification of GST-DHFR-His The purification of the GST-DHFR-His is accomplished in two steps: First the protein will be purified using IMAC. As previously described, the IMAC resin selectively binds polyhistidine-tagged proteins. All other biomolecules will flow through the column. The column is first equilibrated in 20 mM sodium phosphate, 300 mM NaCl and 5 mM imidazole. The 300 mM NaCl prevents the non-specific binding of charged molecules in the E. coli lysate soluble fraction from binding to the column. Since imidazole has a similar structure to histidine (see figure 1.12), the 5 mM imidazole prevents non-specific binding of any E. coli proteins which contain multiple histidine residues, but the imidazole is not at a high enough level to prevent the binding of the polyhistidine tag on the GST-DHFR-His to the Ni-IMAC beads. After the lysate is added and the GST-DHFR-His binds to the resin and the majority of E. coli proteins flow through without binding, the column is washed. The wash buffer contains the same 20 mM sodium phosphate for buffering and 300 mM NaCl to prevent non-specific ionic binding, ONH but also contains a higher level of imidazole. This 10 mM imidazole is slightly more stringent and will wash O away many of the E. coli proteins that were able to bind under the 5 mM imidazole condition. However, N N H3 + 10 mM imidazole is not stringent enough to effectively Imidazole compete with the binding of the polyhistidine tag so the GST-DHFR-His remains bound to the column beads during the wash step. GST-DHFR-His is eluted from the column with a buffer containing 250 mM imidazole. At 250 mM, the imidazole is at a much higher concentration than the GST-DHFR-His Figure 1.12. L-histidine N N H structure compared to effectively competing with the polyhistidine tag for L-histidine imidazole structure. binding to the Ni++ groups of the resin. There are a lot more molecules of imidazole present than GST-DHFRHis so the GST-DHFR-His is knocked off the Ni++ binding sites and elutes from the column. The second step in the purification of GST-DHFR-His is removing excess salt and imidazole from the sample. If the sample is not desalted, during subsequent polyacrylamide gel analysis, sample bands may be fuzzy, broad, skewed, or otherwise distorted. The desalting also removes the imidazole, which interferes with measuring the absorbance at 280 nm, used to estimate protein quantity. 14 Protein Expression and Purification Series Desalting the sample is performed using a size exclusion gel prepacked in a spin column. The gel, Bio-Gel P-6, has a fractionation range of 1,000 to 6,000 Da. This means that the pores of the gel are large enough to allow molecules in the 1 to 6 kD range, like salts and small proteins, to enter, but larger molecules, such as GST-DHFR-His, with a molecular weight of 52 kD, will be excluded and flow through the column. In essence, the salts (imidazole, NaCl and phosphate buffer) are trapped in the gel while the protein of interest comes out “clean” in a Tris buffer. Methods To Quantify Protein Concentration and Check Protein Purity Once the protein of interest (GST-DHFR-His) is purified it is necessary to check its purity and determine the quantity of protein purified. There are multiple ways to perform these tasks. Absorbance at 280nm The aromatic amino acids (tryptophan, and to a lesser degree tyrosine and phenylalanine) in proteins absorb at 280 nm. If the extinction coefficient (a parameter that helps define how well a substance absorbs light at a specific wavelength at a particular concentration) is known, the amount of protein present can be calculated using Beer’s Law (absorbance = εcL) where ε is the extinction coefficient, c is concentration and L is the pathlength of light. If the extinction coefficient is not known, there are computer programs, such as that from Expasy (see Appendix J), that can calculate an approximate extinction coefficient from empirical relationships. It should be noted that other molecules such as imidazole absorb at 280 nm and can interfere with calculations. The buffer in which the sample is measured is critical for A280 measurements. This is one of the reasons why a second purification step can be performed. It is a desalting step to remove the imidazole from the GST-DHFR-His so that the A280 measurement can be taken. Colorimetric Protein Assays There are multiple colorimetric protein assays that have been developed to determine protein concentrations. The first—the Bradford protein assay—is based on a shift in the maximum absorbance of a colored dye, Coomassie Brilliant Blue G-250. The dye interacts mainly with basic amino acid groups (arginine and lysine) as well as aromatic amino acids (phenylalanine, tyrosine and tryptophan). A second method—the Lowry method—is based on reaction of the protein with an alkaline copper tartrate solution and Folin reagent. In the case of the Lowry method, color is mainly due to the presence of tyrosine and tryptophan as well as cysteine and histidine. Each of these assays has its advantages and disadvantages, namely the compatibility of the assay with reagents in the buffer as well as sensitivity. 15 Protein Quantification by Coomassie Assay In this exercise, you will learn how to generate and use a standard curve to determine concentrations of protein from unknown samples. This assay will allow us to then analyze our purified recombinant DHFR sample, to determine if we successfully isolated protein and at what concentration. The sample’s concentration will be needed for further protein verification and functional analyses. Here, you will gain knowledge and practice with micro pipetting, colorimetric assays, spectrophotometry, serial vs parallel dilutions, generation of a standard curve, and calculation of protein concentrations. Gloves must be worn at all times while performing experiments in the lab, and goggles worn here when pipetting and vortexing samples containing Coomassie dye. Glass tubes are disposed of in glass waste containers. Upon completion of this lab exercise, you should be able to: ➢ Describe how Coomassie brilliant blue G-250 dye can be used to detect proteins in solution ➢ Determine how a set of known protein sample concentrations can be utilized to determine the concentrations of unknown samples through the use of a Coomassie colorimetric assay ➢ Identify the unknown sample dilution(s) that allows you to most confidently determine the protein concentration of your sample(s) ➢ Calculate the unknown sample’s concentration taking into consideration dilution factors, where needed ➢ Identify potential sources of variation in the experimental procedure and establish techniques to help minimize experimental error ➢ Suggest when to use serial vs parallel dilutions and why each can be beneficial depending on the particular experimental conditions Background You will be using a Coomassie Plus reagent (Thermo Scientific) to quantify protein by spectrophotometry, a procedure similar to the original Bradford assay (Bradford, 1976) for protein quantification. The Coomassie reagent includes a dye, Coomassie brilliant blue G-250, which produces a color change in the solution upon binding to protein. The dye exists in three different charged forms, with equilibriums of these free dye forms driven by the pH of the environment. Positive, neutral, and negative charges result in red, green, and blue forms of the dye, respectively. In an acidic environment (low pH), like that of the Coomassie Plus reagent, most of the dye will exist in the red, positive charged (doubly protonated) form due to the excess of H+ ions in the solution. However, studies have suggested that it is the blue, negative charged (unprotonated) form of the dye that binds protein (Chial and Splittgerber, 1993). The blue form of the dye binds to protein through non-covalent interactions with arginine and other basic residues, and Van der Waals and hydrophobic interactions with aromatic amino acid side chains are also thought to be involved (Compton and Jones, 1985). 16 So based on this information, how do we understand the assay to work? In the acidic environment of the Coomassie Plus reagent, a small percentage of dye exists in the blue form. In the presence of protein, the blue form will bind, generating blue dye-protein complexes. This binding decreases the amount of free blue dye in solution, shifting the equilibrium to restore blue dye levels, providing more blue form of the dye available to bind protein. The red form absorbs maximally at a wavelength of 470nm and the blue form absorbs maximally at 595nm (Chial et al, 1993). Therefore, the more protein, the more blue dye-protein complexes formed, the more blue color and the higher the absorbance at 595nm by spectrophotometry. Why use an acidic environment for this assay? A low pH, in the absence of protein, results in predominantly red form of the dye, which will provide a nearly “negative” reading at 595nm. The amount of blue dye in an acidic environment is proportional to the amount of protein. Absorbance readings at 595nm will therefore serve to reflect protein concentrations in the solution. (The green form is also present, but has a maximum absorbance at 650nm, so does not interfere significantly with measurements at 595nm.) Alternatively, you could measure proteins directly by spectrophotometry. Proteins absorb maximally in the UV range at a wavelength of 280nm. However, other biomolecules that may be present in solution can also absorb UV light, complicating interpretation of your absorbance reading. For example, DNA absorbs UV light at 280nm (maximally at 260nm), as does RNA. The Coomassie colormetric assay can therefore often allow for more specific analysis of proteins. References Bradford, M.M. 1976. A rapid and sensitive method for the quantification of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem, 72:248-54. Chial, H.J and Splittgerber, A. G. 1993. A comparison of the binding of Coomassie brilliant blue to proteins at low and neutral pH. Anal Biochem, 213: 362-69. Chial, H.J., Thompson, H.B., and Splittgerber, A.G. 1993. A spectral study of the charge forms of Coomassie blue G. Anal Biochem, 209:258-66. Compton, S.J. and Jones, C.G. 1985. Mechanism of dye response and interference in the Bradford protein assay. Anal Biochem, 151:369-74. 17 Your objective: Use a Coomassie colorimetric assay to determine the concentration of an unknown protein sample Step 1: Generate a standard curve from known concentrations of bovine serum albumin (BSA) Step 2: Use your standard curve to determine the protein concentration of your unknown Step 3: Assess areas for improvement/optimization for subsequent protein quantification in the lab Reagents/Materials/Equipment available to you: • • • • • Coomassie Plus Reagent (Thermo Scientific) 2mg/mL BSA (~150ul) Deionized (DI) H20 Pipetmen and pipettes Unknown protein sample (~100ul) • • • • Visible light Spectrophotometer Glass tubes for spectrophotometry 1.5mL tubes for making standards and sample dilutions Vortex Guidelines for generating your standard curve: By establishing a standard curve, you will then be able to place the absorbance value for your unknown on this curve to determine its concentration. Here, you will first generate 4 new samples of BSA in 1.5mL tubes, at set concentrations. These, along with the 2000ug/mL stock, will give you 5 different BSA concentrations for your standard curve: • Based on a known linear working range of BSA concentrations in this assay, set your lowest standard concentration to 100ug/mL and the highest to 2000ug/mL (which is the concentration of your stock BSA solution). • You can then select 3 concentrations in between those values to utilize to generate your standard curve. Use the tables below to establish your conditions. You are also asked to calculate the total ug of BSA in 10uL here because this is the volume of each sample that will be added to the glass tubes for measurement (see general procedure details below). • Be careful with unit conversions! Pay attention to ug vs mg and uL vs mL here! Standard Concentration (ug/mL) 1 100 Total ug BSA in 10uL 2 3 4 5 2000 Based on the above concentrations you have selected to use for your standards, now use the following table to determine the volumes needed to generate these from the 2mg/mL BSA stock provided. You will make a total of 40uL of each standard. This is sufficient volume to perform the experiment and will provide some extra in case you want to run any replicas or need to repeat a measurement. You do not need to generate the 2000ug/mL standard because this is the same concentration as the BSA stock 18 (2mg/mL) you already have. The BSA standards should be diluted in deionized (DI) H2O in 1.5mL tubes. Standard Concentration (ug/mL) Total volume to make 1 100 40uL 2 40uL 3 40uL 4 40uL 5 2000 n/a Volume of 2mg/mL BSA stock (uL) Volume of DI H20 (uL) n/a n/a Once you have completed these two tables, ask your TA/Instructor to check your experimental design and calculations before you proceed. Once your TA/Instructor has checked your work and demonstrated how to utilize the spectrophotometer: • Generate your standards in new, labeled 1.5mL tubes. Be sure to label each tube on the cap and/or on the side of the tube before you get started. • Perform the Coomassie assay to generate your standard curve (see additional guidelines below for experimental procedure). • Be sure to record all steps, in the order you performed them, in your lab notebook. Ask your TA/Instructor if you are not certain about the level of detail you need to include. General Procedures Coomassie Assay: This procedure is utilized for generating the standard curve and for analyzing your unknown samples. You will establish your curve first before you start working with your unknown sample. 1. Add 1mL DI water to each glass tube 2. Add 10uL of standard or unknown sample (10uL DI water for blank) 3. Add 1mL Coomassie Plus Reagent (always add the Coomassie dye last) 4. Gently vortex and incubate at room temperature (RT) for 3-5min. Try to be consistent with the time interval, from addition of Coomassie reagent to measurement of absorbance in the spectrophotometer, for each sample. 5. Blank the spec prior to recording measurements for samples: Set the spectrophotometer to 595nm. Place the tube containing 1mL DI H20 + 10uL DI H20 + 1mL Coomassie in the spec and zero the instrument. You only need to blank the spec when you start, not between each sample. Alternatively, you can blank the spec with water only (no dye) and then subtract out the measurement of your water only + dye control from other samples. Your TA/Instructor will provide guidance for which method to use here. 6. Proceed with measurements of samples, recording absorbance readings at 595nm. 19 Note: It is best to use the same solvent to blank and measure standards as is used in your unknown sample. That may be DI water, like the example given here, but be aware that often the protein sample you will need to quantify is in a particular buffer (perhaps different solvents and often solutes are present in the sample as well) depending on how it was isolated/purified. For example, crude protein samples from cell extracts are often extracted in lysis buffer. Components in the buffer can often impact light absorption by spectrophotometry, making it inaccurate to compare absorption of proteins from different buffer/solution sources. Graphing your standard curve in excel: 1. Enter standard sample concentrations (ug/mL) in one column and corresponding absorbance values in an adjacent column in an excel spreadsheet. 2. Highlight both columns and select insert graph. 3. Choose scatter dot plot format with concentration on the x-axis and absorbance on the y-axis. 4. Add a linear trendline and R2 value to the graph. Depending on the version of excel, these options may be available under the Design tab and Add Chart Element or through Format Chart Area, Chart Options. To show the line equation and R2 value on the graph, select More trendline options. Analysis of your Standard Curve The standard curve can plot the absorbance vs the concentration (e.g. ug/mL) or the absorbance vs the amount (e.g. ug). Here, because we are always adding 10uL of each standard and unknown sample to the glass tube, with the same volumes of water and dye, we can simplify our analysis and follow the concentration of the sample examined. However, if you chose to, you could also calculate and plot the total ug of protein added to the glass tube and then calculate back to determine the concentration of the sample added. Protein standard curves are not completely linear in nature when plotting absorbance vs concentration/amount. There is a range of protein concentrations where absorbance is directly proportional to concentration. However, absorbance readings falling outside of this linear working range do not provide accurate measurements of protein concentration. Too little protein can fall below the threshold of detection, and too much protein can saturate the reaction. Here, you have guidance for which concentrations to use at each end of your standard curve range. These were designed in efforts to allow you to work within the known linear range of BSA in this assay and to span as much of that range as possible. Once you have measured and plotted the absorbance values for your standards to generate your standard curve, discuss with your TA/Instructor to determine if you are ready to proceed with measurement of your unknown sample. Does your graph look linear within the range tested? How confident are you in your measurements? What does the trendline equation tell you? R2 value? 20 Analysis of your Unknown Protein Sample Note which unknown sample your group is analyzing: _______ Typically you would set up your unknown sample tubes along with your standards to keep all conditions in the Coomassie assay as consistent as possible, processing them together. However, because this is the first time we are constructing a standard curve, here you will generate the curve first and then analyze your unknown samples once you have generated a functional standard curve. Take a look at your standard curve once you have it completed. Ideally where would you like absorbance of your unknown sample to fall within the curve to give you most confidence in accuracy of your measurement? What happens if your unknown protein sample falls below or above the linear range of your standard curve? If your unknown falls below the linear region of your curve, there is not much we can do using this particular assay with your current sample. If your unknown falls above the linear range of your curve, that issue can be easily resolved! Dilute the sample to a dilution that now falls within the linear range. Then the dilution factor can be used to calculate the concentration of your original (undiluted) unknown sample. Typically, researchers will perform several 3-10 fold serial dilutions of their unknown sample if the original concentration is too high when measured directly. How to determine if dilutions are needed and if so, how to estimate the dilution(s) needed other than through trial and error? Hint: Take a look at the color of the sample when adding Coomassie reagent to the glass tube with your 10uL of unknown. You should be able to approximate by finding dilutions that fit within the color range of your standards. Keep in mind there is only ~100uL in the unknown stock you were provided with, so be careful to plan accordingly. If you use serial dilution to make your unknown dilutions, be sure to calculate how much total volume you need of each dilution. For example, if you made three 5 fold serial dilutions from your original 1:1 (100%) sample stock: 1:5, 1:25, and 1:125, start by determining how much volume you need of the most dilute, then calculate back from there. Hint: make the math as simple as possible without being wasteful of reagent! Note: Don’t dilute your unknown directly in the original sample tube. Your protein samples will often be used in further analysis, with the Coomassie assay serving as simply a means to quantify protein concentration for further applications. Set up new, labeled 1.5mL tubes to generate 3 dilutions of your unknown if you find your sample is too concentrated to analyze directly. Use the table below to guide you, and check your work with your TA/Instructor before proceeding to dilute your unknown. Unknown Dilutions Total volume to make (uL) Unknown dilution to use as “stock” Volume of unknown “stock” (uL) Volume of DI H20 (uL) 1:1* n/a n/a n/a n/a 1:1 *Here, notation of dilution denotes part:whole 21 Use this page to record your absorbance readings for your standard and unknown samples Tube # Sample Absorbance at 595nm Troubleshooting: Check your calculations, units, and conversions Be sure to fully mix (by vortexing or pipetting) any dilutions made prior to analyzing them Check that pipettes are set to correct volumes. Remember these general pipetting procedures: • • • • • • • Be sure to use the correct pipet size for the pipetman in use. To avoid contamination of samples and reagents, use a fresh tip for each pipetting action, ensure the pipet tip does not come in contact with any other surface, and keep the pipetman upright while in use. Be sure not to go beyond the first stop when preparing to draw liquid into the pipette. Keep an eye on what you are doing – pipette slowly and carefully, watching the liquid as it is drawn into the pipet to ensure the pipetman is set properly and watching as the liquid is dispensed to ensure all liquid is transferred. Avoid bubbles. Place the pipet tip right below the surface of the sample as submerging it too far will draw up more sample than intended and can risk contamination if the pipetman itself comes in contact with the sample or inside of the container. It is good practice when adding multiple samples to a new tube to transfer the largest volume first. 22 Protein Expression and Purification Series SDS-PAGE and Western Blot SDS-PAGE SDS-PAGE Analysis Another method of determining which fractions contain the purified protein as well as the progress of the protein purification procedure, is to analyze samples by sodium dodecyl sulfatepolyacrylamide gel electrophoresis (SDS-PAGE). This method is not quantitative unless a protein standard of known concentration is run in one of the lanes and quantitative software is used to examine the gel image. It will, however, allow the determination of which fractions contain the protein of interest if the molecular mass is known and at what relative concentration. It will also allow the assessment of the purity of the protein fraction. If the protein is pure, a single band should be visible on the gel, even when large quantities of the samples are loaded. SDS-PAGE is also the first step for proceeding with protein-specific analysis to verify the successful isolation of the protein of interest by Western Blot, provided in more detail below. Protein Structures and Basic Properties In contrast to DNA, which is quantified in terms of its length (i.e., the number of base pairs), proteins are quantified in terms of their molecular weights relative to a hydrogen atom, in Daltons. This is because DNA is composed of only 4 nucleotides, which are in roughly equal proportions and about the same molecular weight. Proteins on the other hand are composed of 20 amino acids with molecular weights from 89 to 204 Daltons (the average is 110). They vary considerably in amino acid composition. One Dalton equals the mass of a hydrogen atom, which is 1.66 x 10-24 grams. Most proteins have masses on the order of thousands of Daltons, so the term kilodalton (kD) is used for protein molecular masses. Proteins range in size from several kilodaltons to thousands of kilodaltons but most fall between the range of 10 kD and 220 kD. DHFR-GST-His has a primary structure of 410 amino acids, a total molecular weight of 52,000 daltons, or 52 kD. Using Gel Electrophoresis to Separate and Identify Proteins A protein’s electrical charge and its mass affect its mobility through a gel during electrophoresis. The ratio of charge to mass is called charge density. Since every protein is made of a unique combination of amino acids, the net charge of each protein may be different. The electric charge of proteins must be removed as a factor affecting migration in order for polyacrylamide electrophoresis to be effective as a method of protein molecular weight determination. The intrinsic charges of proteins are masked by placing a strongly anionic (negatively charged) detergent, sodium dodecyl sulfate (SDS), in both the sample buffer and the gel running buffer. SDS binds to and coats the proteins and also keeps them denatured as relatively linear chains. In this form, proteins migrate in a polyacrylamide gel as if they have equivalent negative charge densities, and mass becomes the main variable affecting the migration rate of each protein. (Note: Posttranslational modifications such as glycosylation can also affect protein migration). 23 Fig. 1.13. The combination of heat and the detergent SDS denatures proteins for SDS-PAGE analysis. Aside from obscuring protein charge with SDS, to effectively determine the molecular weight, the secondary (2°), tertiary (3°), and quaternary (4°) structures of the protein complexes within a protein extract are also disrupted prior to electrophoresis. This process of structural disruption is called denaturation. A reducing agent, such as β-mercaptoethanol (BME) or dithiothreitol (DTT), is sometimes added to samples to ensure complete breakage of disulfide bonds. (In the case of GST-DHFR-His, no reducing agent is needed as there are no disulfide bonds in the protein structure.) Three factors—heat, ionic detergent, and reducing agent—completely disrupt the 2°, 3°, and 4° structures of proteins and protein complexes, resulting in linear chains of amino acids. The denatured amino acid chains move through the gel at rates proportional to their molecular masses. Performing Electrophoresis In this lab, the induction of expression of GST-DHFR-His, solubility of the expressed GST-DHFR-His, and success of purification will be analyzed by SDS-PAGE, followed by Western Blot. To do this, a portion of the fractions will be run on an SDS-PAGE gel against a protein standard of known molecular weight. The samples of the fractions have Laemmli sample buffer added to them and then will be loaded into the wells of a polyacrylamide gel. Once the gel is placed in the electrophoresis cell, the lower and upper chambers are filled with running buffer. The lower part of the cell contains the anode, or positive pole, and the top one contains the cathode, or negative pole. Once assembled, the electrophoresis cell is connected to a power supply. The proteins, now negatively charged due to the presence of SDS, will flow with the electric field toward the anode. When the dye front (from the sample loading dye) reaches the end of the gel, electrophoresis is stopped. The gel will be stained with the Coomassie blue dye. The stained gel will allow us to check the purity of the fractions and quality and relative quantity of the recombinant protein produced. 24 Detection and analysis of recombinant dihydrofolate reductase by SDSPAGE and Western Blot Wear lab coat & gloves at all times. Goggles required when heating samples and handling toxic chemicals. Frequently inspect gloves for tears/contamination. Hazardous reagents requiring special chemical waste disposal: Acrylamide gels, Methanol-containing transfer buffer. SDS PAGE of purified protein samples In addition to your purified GST-DHFR-His samples, we will also be including two other DHFR fusion proteins as controls. Here is a list of samples for SDS-PAGE and Western Blot Analysis: • • • • Your expressed and purified GST-DHFR-His samples for analysis A purified His-tagged DHFR sample, also expressed and purified from E. coli Whole cell lysate from HEK293T cells overexpressing Myc-Flag-tagged DHFR Whole cell lysate control from HEK293T cells Gel Apparatus Assembly 1. Two groups of 4 students will share a pre-cast, 12%, 12+2 well TGX polyacrylamide gel (BioRad 5671043). Three gels total per lab section. To prepare the gel for electrophoresis: a. Remove gel from packaging, rinse with distilled (DI) water, carefully remove gel comb b. Rinse wells with DI water twice, each time inverting gels and shaking to remove excess water from wells c. Remove tape from the bottom of the gel cassette to expose the bottom of the gel 2. Place the gel in the electrophoresis chamber and fill the buffer chamber(s) with 1X Running Buffer so that the top of the wells are covered. 3. Carefully rinse wells by pipetting to remove any bubbles. Sample Preparation 1. Purified protein and cell lysate samples have already been prepared and denatured in Laemmli sample buffer. Aliquots of your GST-DHFR-His samples, the His-tagged DHFR, the Myc-Flag-tagged DHFR containing cell lysate, and control cell lysate will be provided by your TA. 2. WEAR GOGGLES: Heat samples for 2min in the heat block at 95C. (Ensure each tube has a small hole to prevent top from popping off during incubation, ask your TA for assistance). 3. Centrifuge samples briefly (quick spin) and maintain at room temp (RT) for gel loading (do not place back on ice or SDS will precipitate out of solution). 25 4. Obtain an aliquot of the each of the following: 1X Laemmli buffer and the Kaleidoscope prestained protein standard (BioRad 1610375). (Ok to heat Kaleidoscope standard as well, but not required) Gel Loading 1. Record the order/location of sample loading in the table below. Each gel should contain two sets of Kaleidoscope standard and 4 samples. It is best to leave empty wells on the exterior and/or between groups when possible. These empty wells will be filled with 1X Laemmli to ensure even running of the gel. To maintain consistency in the transfer setup instructions, load the protein standard on the left for each set of samples. 1 2 3 4 5 6 7 8 9 10 11 12 2. Load 15uL of undiluted Kaleidoscope prestained standard (molecular weight marker) and 20uL of each purified protein (0.1ug/uL-0.15ug/uL) and lysate (0.75ug/uL) sample in the wells designated in your table above. Load slowly, avoid bubbles, and be careful not to overfill wells. Check with your TA to see if any of these volumes and concentrations need to be adjusted/optimized from that listed here. 3. Load 20uL of 1X Laemmli into any empty wells. 4. Place the lid on the electrophoresis chamber, connect leads, and run the gel at 300 volts for 20-30min (for TGX gels). Run until the dye front has reached the bottom third of the gel. 5. Prepare materials for transfer (see section below): 4 pieces of whatman paper, 1 piece of nitrocellulose filter, 2 Scotchbrite pads, 1 transfer clamp, small container with DI water, small container with transfer buffer, larger container for transfer setup. 6. Turn power supply off, disconnect leads, and remove lid from the electrophoresis chamber. 7. Carefully remove the gel cassette from the chamber (running buffer may be poured out in the sink where needed). 8. Disassemble the gel cassette to remove the gel. Carefully pry the two plastic plates apart. Typically the gel will remain attached to one plate. Remove the gel by gently detaching edges from plastic plate when you are ready to assemble transfer apparatus (below). 9. Your TA/Instructor will need to cut the gel into 2 pieces to separate it for you to do a total protein stain to analyze the SDS-PAGE result directly and to proceed with transfer for Western Blot analysis. 10. It may be helpful to take a picture of the gel after running to note the location of the protein standard bands in case there is any issue with transfer of the ladder. With one half of the gel: Stain with Gel Code Blue for total protein stain analysis 1. Place the gel half in a tray with ~100mL DI water. 26 2. Rinse the gel three times, 5min each in DI water, with gentle rocking. (Water rinses may be disposed of in the sink) 3. WEAR GOGGLES: Stain the gel in 70mL activated GelCode Blue (ThermoFisher, coomassie G-250 dyebased protein stain) for 30-60min, with gentle rocking. (Dispose of used GelCode Blue solution in chemical waste receptacle) 4. Destain in 100-200mL DI water if needed for 15-60min. (Dispose of first wash in GelCode chemical waste receptacle) 5. Take a picture of the gel to record your data and dispose of the gel in the acrylamide chemical waste receptacle. Rinse electrophoresis chamber and trays with DI water and hang on the drying rack to dry. 6. Use the protein standard to estimate the molecular weight of bands observed. How does this result fit with your predicted result and why? Western Blot With the other half of the gel: Transfer of proteins to a nitrocellulose filter after SDS-PAGE for Western Blot analysis 1. Carefully label the nitrocellulose filter with your group # or initial, in pencil, in the upper left corner and place it in a small tray with DI water so that the filter is fully submerged. Always wear gloves and handle the filter as little as possible, picking it up only at by edges. Be sure to take the filter and not the pieces of paper. The filter is protected by a piece of paper on either side before use. 2. Assemble the transfer materials in the larger tray in the following order: (See image on next page) a. Place the black side of the transfer clamp in the tray and add some transfer buffer, just to cover the base of the clamp b. Pre-soak one scotchbrite pad in transfer buffer and place it on the bottom of the clamp in the tray to begin building the sandwich. c. Pre-soak two pieces of whatman paper in transfer buffer and layer them one at a time on top of the scotchbrite pad. Place each on top of the previous layer starting from one edge, side to side. d. Carefully place gel on the whatman paper, “upside down” so that the protein standard is on the right. Place it on top of the filter paper starting from one edge, side to side. Ensure the entire gel piece is on top of the whatman paper, and be careful to not introduce any bubbles or creases between the gel and the whatman paper. e. Remove the nitrocellulose membrane from the DI water and carefully place it on top of the gel, with a side to side action, “upside down” with your initials facing down, on the side with the protein standard. Avoid bubbles. (Imagine after the proteins transfer from the gel to the filter, you will see the protein standard on the left side of the filter once it is peeled back off the gel). 27 f. Pre-soak two pieces of whatman paper in transfer buffer and layer them one at a time on top of the filter. Place each on top of the previous layer starting from one edge, side to side, avoiding bubbles. g. Pre-soak one scotchbrite pad in transfer buffer and place it on top to complete the sandwich. h. Close transfer clamp (clear side now on top of sandwich). i. Place the transfer sandwich in the gel box. Ensure correct orientation so that proteins will transfer (-) to (+) from the gel to the filter. 3. Each transfer gel box can accommodate two gel transfers. Once both transfer sandwiches are placed in the gel box, add transfer buffer to cover the top of the sandwiches. Place lid on the gel box, connect leads, and run at constant amps, 100mA for at least 1hr. 4. After the transfer, carefully disassemble the transfer sandwich to remove the filter (the blot). Note the location of the molecular weight protein standard bands in case they become less visible as the blot is further processed. Transfer buffer (containing methanol) is collected as hazardous chemical liquid waste & acrylamide gels are collected as hazardous chemical solid waste. Be sure to use the appropriate waste containers for each. Transfer buffer can be re-used a second time prior to disposal. 5. Block the filter to prepare it for Western analysis: Place the blot in a small dish with 5% dry milk solution (in TBST buffer) for 25-30min with gentle rocking. Ensure protein side of blot is fully covered by blocking solution (this should be the side with your group initials). Alternatively, the blot can be blocked overnight, but cover to avoid evaporation. 6. Your TA will help rinse the blot in TBST and wrap it in plastic wrap to be stored at 4C until the next lab period. 28 Western Blot analysis of purified protein and cell lysate samples (all steps performed at room temperature) 1. Obtain your blot from the previous week’s transfer, remove the plastic wrap, and submerge it in a small tray of TBS for a few minutes. Remember that the blocking step has already been performed. Now you will proceed with the primary antibody incubation. 2. Decant the TBS buffer from the tray and add 5mL of the primary antibody solution. This solution is made by adding primary antibody to 5% dry milk block solution in TBST. • Primary antibody dilutions can vary depending on the antibody used. Be sure to check with your TA to note the rabbit polyclonal primary antibody your lab group has been assigned (for example, anti-DHFR or anti-GST) and the dilution factor for that particular antibody. Then you can calculate the volume of antibody stock needed to make 5mL of primary antibody solution. o Primary antibody:__anti-______________ o Primary antibody dilution:___1:_____________ o How many uL antibody stock to add per 5mL primary antibody solution? __________ uL 3. Ensure the primary antibody solution fully covers the blot as this volume is limited. Cover the tray with plastic wrap to reduce evaporation and incubate for 45min with gentle rocking. 4. Perform wash step: • Decant the primary antibody solution and rinse the blot briefly with 10mL of TBST • Decant the rinse and add ~10mL of fresh TBST, incubate for 8min with gentle rocking • Decant TBST wash and repeat with 2 more ~10mL TBST washes 5. Decant the final TBST wash and add 5mL of secondary antibody solution. This solution is made by adding secondary antibody (goat-anti-rabbit alkaline phosphatase) to 5% dry milk block solution in TBST. Incubate for 35min with gentle rocking. • Typically, this is a 1:1000 dilution (5uL antibody in 5mL solution), but check with your TA to note the dilution factor of the secondary antibody here:_____________ 6. Perform wash step: • Decant the secondary antibody solution and rinse the blot briefly with 10mL of TBST • Decant the rinse and add ~10mL of fresh TBST, incubate for 8min with gentle rocking • Decant TBST wash and repeat with 2 more ~10mL TBST washes 7. After the last wash step, place the blot in TBS prior to developing. 8. Develop the blot to visualize proteins bound by your primary antibody, through colorimetric detection of secondary antibody localization on the blot: 29 • • • • • You will use a NBT/BCIP substrate solution that is metabolized by the alkaline phosphatase enzyme attached to the secondary antibody to generate a dark blue/purple precipitate. Decant the TBS and move the blot to a fresh tray, face up. Add ~2mL of the substrate solution. (Do not allow blot to dry prior to adding the substrate solution). Ensure the substrate solution completely covers the top of the blot and watch for development of bands over the course of 2-10min (no rocking). Once desired intensity of bands, without too much background signal, is achieved, rinse the blot with DI water to stop the reaction. Take a picture of the developed blot to record your data. Note the location of molecular weight protein standard bands to estimate the size of any proteins visualized on the gel. 30 Computational Sequence Analysis Sequence analysis of tagged DHFR fusion proteins Each nucleotide coding sequence used to make a protein has 3 possible reading frames. Which series of 3 sequential nucleotides group as codons to be “read” by the translation machinery depends on where translation starts. Double-stranded DNA sequence has 6 possible reading frames because gene coding sequence could be on either strand. The nucleotide sequence you copy and paste into expasy translate below will be analyzed considering all 6 possible reading frames, 3 on the 5’ to 3’ sequence entered, and 3 on the anti-parallel complementary strand. In the cell, the ribosome will scan to find the translation start site (methionine ATG start codon) and that sets the reading frame. The next 3 nucleotides after the ATG start codon will be “read” by the ribosome/corresponding tRNA to place the next amino acid on the growing polypeptide chain, etc. until it reaches a stop codon. You are looking for a successful open reading frame result from your expasy result to identify the correct reading frame. In other words, which grouping of 3 nucleotides the ribosome would read to successfully translate the encoded protein. Example: Reading frame 1: 5’ CGA TGT CCG AGT CAC ACT TAT… 3’ Reading frame 2: 5’ C GAT GTC CGA GTC ACA CTT AT… 3’ *Reading frame 3: 5’ CG ATG TCC GAG TCA CAC TTA T… 3’ *Reading frame 3 has the ATG start codon shown here “in-frame” 1. Use the nucleotide sequences provided to determine the amino acid sequence and expected molecular weight of each tagged DHFR fusion protein analyzed. The following online bioinformatics tool set is available to help you translate nucleotide sequences and determine the molecular weight from the amino acid sequence: https://www.expasy.org/ a. To translate nucleotide sequence to amino acid: Use the translate tool under the proteomics link: http://web.expasy.org/translate/ • Copy and paste the nucleotide sequence into the search box -> Click translate -> Scroll down to see all possible reading frame results -> Select the correct translated result giving the full length protein amino acid sequence -> Click on the starting methionine “M” to retrieve text and FASTA format protein sequence • Keep track of the protein sequences produced by copy/pasting into a word doc file for your own record – be sure to label each sequence so that you know which is which for subsequent analysis steps b. To determine the molecular weight in Daltons (Da) from an amino acid sequence: Use the Compute pI/Mw tool under the proteomics link: http://web.expasy.org/compute_pi/ • Copy and paste protein sequence into the expasy molecular weight tool search box ->Click Compute -> Record molecular weight (mw), which is provided...
Purchase answer to see full attachment