Central Florida College Winter Park DNA Replication Questions

User Generated

fvkk

Science

Central Florida College Winter Park

Description

Unformatted Attachment Preview

Open the link to the games: https://biomanbio.com/HTML5GamesandLabs/LifeChemgames/protsynthracehtml5page.html Follow the instructions given in the game, which, at first, is mostly reading the material in the white boxes and then clicking on the item the box tells you to. The transcription game has you matching RNA nucleotides to the DNA strand. You click on the RNA “letter” to complement the DNA strand in order. This is timed. If you miss an appropriate nucleotide, your accuracy score goes down. Once you have completed the game, make sure you get a screenshot of the game screen including the mRNA and the time and accuracy at the bottom of the game screen BEFORE YOU GO TO the next screens. In the next screen you use the down arrow and right arrow to move your mRNA off screen. You then have to answer a few questions about transcription before moving to the translation game. The next animated screen has you use the right and up arrow keys to move the mRNA out of the nucleus and to the ribosome. Then click the button to TRANSLATE your mRNA. This will take you to some introductory material about the Translation Game. In the translation game, you are asked to click on the start codon. That would be at the beginning of the mRNA at the bottom left. AUG is the start codon. The game then asks you to click on the tRNA at the top that has an anticodon complementary to the codon. Remember, A complements U, while C complements G. So you would pick the one with UAC, which is complementary to the codon AUG. A high pitched sound says you have picked it. You then use the arrow keys to move it (not your mouse! Ugh) down to the mRNA codon. That’s just sort of a practice, I guess. When you click I GOT IT, the instructions say to hook up you tRNA with the correct amino acid – the colored balls. You have to use the key in the upper right to match the codon (not the anticodon on the tRNA) with the appropriately colored ball. You can load up all of the tRNAs before the game starts by clicking on them, then using the arrow to move them around to the right amino acid ball (based on the codon figure key in the upper right) Now use the arrow keys to bring the tRNA with the UAC anticodon down to the AUG again. It will slide into place when you are pretty close. When you click I GET IT, the game begins. You have to load your next tRNA with an amino acid before you can bring it down to the next codon on the mRNA. So if you haven’t already, click on the tRNA with the appropriate anticodon, use the key to figure out the right colored amino acid ball, then use your arrow keys (again, not your mouse) to move the tRNA to the ball and then down to the codon on the mRNA. When you get the right tRNA in the right place, next to the other tRNA in the ribosome, the ribosome takes your tRNA, hooks the previous amino acid to that amino acid and ejects the spent tRNA. Repeat the process of checking out the next three nucleotides on the mRNA (the codon), finding the tRNA with the right anticodon, moving it around until you connect it with the correct amino acid ball (IF IT DOESN’T ALREADY HAVE AN AMINO ACID BALL ON IT), using the arrow keys, then moving it down to the codon. When the amino acid chain is finished, the ribosome will start floating off. Take a screen shot of the game screen with your finished chain. Make sure you get screen shots of your transcription and your translation screens when you finish the transcription or translation. I have not found a way to go back if I have moved on. Attach you pictures to a word document, save your document, and submit through the assignment link. DNA replication What is the nucleotide sequence of the strand that is complementary to this strand? 5’ ATCTTCGATTTCGGCCCTAGTCGATT…………… 3’ Transcription The sequence below represents a gene being transcribed. If this is the template strand, what is the nucleotide sequence of the primary transcript? 3’ ATCTTACGATTTCGGCCCTAGTCGATT 5’ Translation: find the start codon AUG on the mRNA below, underline nucleotides in sets of three (codons), find the appropriate amino acid for each codon in the chart below, and stop when you come to a stop codon. Translate the following mRNA. AACACCAUGACCUACAUAGGGAGGGACUUAGUAGCGGAGGGGUGAUCAUUA The genetic code UUU UUC UUA UUG phenylalanine phenylalanine leucine leucine UCU UCC UCA UCG serine serine serine serine UAU UAC UAA UAG tyrosine tyrosine STOP STOP UGU UGC UGA UGG cysteine cysteine STOP tryptophan CUU CUC CUA CUG leucine leucine leucine leucine CCU CCC CCA CCG proline proline proline proline CAU CAC CAA CAG histidine histidine glutamine glutamine CGU CGC CGA CGG arginine arginine arginine arginine AUU AUC AUA AUG isoleucine isoleucine isoleucine Methionine START ACU ACC ACA ACG threonine threonine threonine threonine AAU AAC AAA AAG asparagine asparagine lysine lysine AGU AGC AGA AGG serine serine arginine arginine GUU GUC GUA GUG valine valine valine valine GCU GCC GCA GCG alanine alanine alanine alanine GAU GAC GAA GAG aspartate aspartate glutamate glutamate GGU GGC GGA GGG glycine glycine glycine glycine
Purchase answer to see full attachment
User generated content is uploaded by users for the purposes of learning and should be used following Studypool's honor code & terms of service.

Explanation & Answer

View attached explanation and answer. Let me know if you have any questions.

Additional screenshots


DNA replication

What is the nucleotide sequence of the strand that is complementary to this strand?
5’ ATCTTCGATTTCGGCCCTAGTCGATT…………… 3’
3’ TAGAAGCTAAAGCCGGGATCAGCTAA……………5’

Transcription
The sequence below represents a gene being transcribed. I...


Anonymous
Just what I needed…Fantastic!

Studypool
4.7
Trustpilot
4.5
Sitejabber
4.4

Similar Content

Related Tags