Molecular Biology: A Laboratory Manual ALAM NUR-E-KAMAL PH.D. Professor, Biology alam@mec.cuny.edu 1 Laboratory 1. Laboratory Safety, Metric System, and Micropipette Challenge Exercise 1. Laboratory safety. Laboratory safety is defined as the ways to minimize potential danger to human and environment. Following safety is recommended to minimize accident in laboratory. Objective: A. Become familiar with laboratory and surroundings: 1. Identify and locate exits, fire extinguishers, chemical showers, and eye wash. 2. Locate general and biohazard disposal containers. 3. Locate telephone set to use in case of emergency. 4. Locate fume hood and learn when you should use fume hood. B. Safety signs and symbols: The National Fire Protection Association (NFPA) has developed a labeling system. It consists of 4 sections in color with a numerical code: Blue: health hazard Red: fire hazard Yellow: reactivity/instability hazard White: special hazard Signs and symbols of Hazard: http://en.wikipedia.org/wiki/Hazard_symbol Write down location of the following safety equipments: Fume hood: ---------------------------------------------------------Safety shower: -----------------------------------------------------Eyewash shower: --------------------------------------------------Fire extinguisher: ----------------------------------------------------Floor map of the building: ------------------------------------------Assembly place in case of emergency evacuation: ------------------- 2 C. Rules for disposing laboratory waste: It is required to follow the rules in disposing laboratory waste to maintain safe and legal operation of laboratory. You must follow these rules. In the following sections, record information as instructed by your instructor. Empty test tube, beaker, conical flask, pipettes --------------------------------------------------Broken glass apparatus (beaker, test tube, graduated cylinder etc.) ---------------------------Microscopic slide with biological sample (eg. Leaf, bacteria, cheek cell) -------------------Apparatus (eg. Pipettes, test tubes) used to transfer bacteria -----------------------------------Electrophoresis gels ----------------------------------------------------------------------------------Chloroform, acetic acid, methanol, ethanol ------------------------------------------------------Bacterial plates ---------------------------------------------------------------------------------------- D. Rules to follow: Each student should follow the following rules while working in the laboratory: I. Do not: *eat, drink, and smoke in the laboratory area. *enter the laboratory in absence of your supervisor. *leave any instrument turned “on” or plugged “in” while leaving the laboratory. *discard any chemical in the sink. *use cell phone while working in the laboratory. *make loud conversation and any inappropriate conversation in the laboratory. II. Do: *Keep all books, coats, purses, backpacks etc. in designated areas. 3 *wear lab coats and safety glasses in each session of laboratory. * Inform your teacher if you are pregnant, color blind, and allergic to any chemicals. * review laboratory exercise BEFORE coming to the lab session and identify potential hazardous material. *read complete lab session and make a plan to perform experiments. * use only labeled chemicals and reagents. *ask questions to your instructor BEFORE you attempt a procedure that is not clear to you. *return all apparatus, chemicals, and reagents in appropriate places. *rinse all containers with water and dispose waste in designated containers. *clean your hands and working area with disinfectants. I have carefully read the above regulations and understood its content. I fully agree to comply with the rules and understand that violation of these regulations may result in expulsion from the laboratory. Student name: Date: ------------------------------------Course name: 4 Signature: ------------------------------Instructor: Exercise 2. Metric Units and measurement (Please see next page) A standard system of measurement commonly used in science. The units are: meter as a unit length, the gram as a unit mass, liter as a unit of volume, and the second as a unit time. Rulers are used to measure length. Graduated pipettes, graduated cylinders, volumetric flasks, beakers and conical flasks are used to measure volume of a liquid, Objective Learn units of metric system. Learn conversion of units. Familiarize with common apparatus used in biology laboratory. Understand importance of volume measurement. Learn how to obtain data and interpret scientific information. Materials: 1. Ruler 5.Graduated cylinder: 100 ml 2. Beakers : 250 ml 6. Pipettes: 10 ml 3. Pipettes pump 7. Balance. 4. Test tube 2. Units of measurement: A unit of measurement is a definite amount of a property such as length, volume, or mass. Scientists measure things using metric system. Units used for metric system are: meter (m) for length, gram (g) for weight, and liter for volume. Some prefixes are used to express systematic relationship in a particular type of unit. 5 Table I: Prefixes in metric system Decimal Prefix Symbol 1,000,000,000,000,000,000 1,000,000,000,000,000 1,000,000,000,000 1,000,000,000 1,000,000 1,000 100 10 1 0.1 0.01 0.001 0.000001 0.000000001 0.000000000001 0.000000000000001 0.000000000000000001 exa E peta P tera T giga G mega M kilo K hecto H deca da basic unit, no prefix deci d centi c milli m micro  nano n pico p femto f atto a Power to 10 1018 1015 1012 109 106 103 102 101 100 10-1 10-2 10-3 10-6 10-9 10-12 10-15 10-18 Exercise 3. Micropipette Challenge Laboratory science often involves working with very small volumes of liquid. Accurate transfer of such a small volume of liquid is critical and challenging especially enzymatic reactions with protein, RNA, and DNA. Scientists working in pharmaceutical industry, biotechnology laboratory, hospital, research laboratory etc. need to acquire skill in using micropipette. Objective 1. Become familiar with different types of micropipette. 2. Transfer small volume (µL) of liquid. 3. Determine color spectrum. 6 Practice I: Procedure to use Micropipette: To draw liquid into the micropipette tip a. Depress the button located at the top to the first stop and hold your finger at this position. b. Submerge the end of the tip below (2-3 mm) the fluid you want to withdraw. Slowly release your finger keeping micropipette tip submerged in the liquid. Make sure that no air bubbles created in liquid withdrawn in micropipette tip. c. Take Micropipette out of the liquid. To dispense liquid in a new container a. Put the tip inside the container (touching inside/bottom) surface of the container you want to dispense b. Press the button to dispense the liquid. You need to press the button to first stop, and then to second stop to make sure that you have dispensed all liquid. c. Eject tip into appropriate waste container. d. Following the same procedure, take volumes as directed in the Table and follow instruction. Practice II Materials 1. 2. 3. 4. 5. Six test tubes Three colored solutions: Red, blue, yellow Water Micropipette p1000 Tips Methods A. Setting up your tubes: 7 Label (1, 2, 3, 4, 5, and 6) the six tubes at your station. Put 2100 µL of red water solution into test tube number 1 Put 2300 µL of yellow water solution into test tube number 3 Put 2500 µL of blue water solution into test tube number 5 B. Constructing color spectrum: Make sure you record action in Table II below: Take 500 µL from test tube number 1 and add it into test tube number 2. Take 500 µL from test tube number 1 and add it into test tube number 6. Take Take 500 µL from test tube number 3 and add it into test tube number 4 500 µL from test tube number 3 and add it into test tube number 2 Take 500 µL from test tube number 5 and add it into test tube number 4 Take 500 µL from test tube number 5 and add it into test tube number 6 C. Crunching the numbers: Calculate the total final volume of liquid in each tube. Convert volume from µL to ml Write color appeared in final solution 8 Table II. Record addition and subtraction Test Tube Starting volume Amount ( µL) Total volume Number Total volume (µL) Color to be added added ( µL) 1 2100 (red) 2 0 µL 3 2300 (yellow) 4 0 µL 5 2500 (blue) 6 0 µL subtracted Practice III Materials 1. 2. 3. 4. 5. Six 1.5 ml tubes Three colored solutions: Red, blue, yellow Water Micropipettes (p100. P10) Tips (yellow) 9 (mL) Color of the solution Methods A. Setting up your tubes: Label (1, 2, 3, 4, 5, and 6) the six 1.5 ml size tubes at your station. Put 25 µL of red water solution into test tube number 1 Put 30 µL of yellow water solution into test tube number 3 Put 40 µL of blue water solution into test tube number 5 B. Constructing color spectrum: Make sure you record action in Table II below: Take 5 µL from tube number 1 and add it into tube number 2. Take 5µL from tube number 1 and add it into tube number 6. Take 5 µL from tube number 3 and add it into test tube number 4 Take 7 µL from tube number 3 and add it into tube number 2 Take 7 µL from tube number 5 and add it into tube number 4 Take 7 µL from tube number 5 and add it into tube number 6 C. Crunching the numbers: Calculate the total final volume of liquid in each tube. Convert volume from µL to ml Write color appeared in final solution 10 Table III. Record addition and subtraction Tube Starting volume ( µL) Number color to be added 1 25 2 0 3 30 4 0 5 40 6 0 Amount (µL) added Subtracted 11 Total volume Total volume (µL) (mL) Color of the solution Post lab questions: 1. List five important safety precautions should be taken while working in a molecular biology lab. 2. What are the advantages of using micropipette ? 3. List different size of micropipettes you used in the laboratory. 4. What is the range of liquid volume recommended for each type of micropipette ? P1000 : P100: P10: 5. Convert the following units: 20 g = M = 25 µg = ng mM = µM 12 Self study: SOLUTIONS 1. PERCENT SOLUTIONS Parts of a solute per 100 total parts of solution. A. % W/W Percent of weight of solute in the total weight of the solution. Example: A 100% (W/W) NaCl solution is made by weighing 100 g NaCL and dissolving in 100 g of solution. B. % W/VPercent of weight of solution in the total volume of solution. Example: A 4% (W/V) NaCl solution is 4 g of NaCl in 100 mL of solution. C. % V/V Percent of volume of solute in the total volume of solution %V/V. Example: A 10% (V/V) ethanol solution is 10 mL of ethanol in 100 mL of solution; unless otherwise stated, water is the solvent. 2. MOLAR SOLUTIONS (M) The definition of molar solution is a solution that contains 1 mole of solute in each liter of solution. A mole is the number of gram molecular weights. Therefore, we can also say a 1M = 1 gMW solute/liter solution. PROBLEMS A. How would you make a liter of 4M CaCl2? CaCl2 = 111 (MW) B. How would you make 300 mL of a 0.5M NaOH solution? NaOH = 40 (MW) 13 3. Making diluted solutions: Many times the solutions we make are made from more concentrated solutions rather than dry chemicals. For figuring these out it can just be easier to remember a formula than figuring them out. That formula is: V1C1 = V2C2 where V = volume C = concentration (%, M, N) SAMPLE PROBLEMS: 1. How much 12 N HCl do you need to make 400 mL of 2N solution? 14 Lab 2: Central Dogma of Molecular Biology: replication, transcription, and translation The discovery in 1953 of the double helix, the twisted-ladder structure of deoxyribonucleic acid (DNA), by James Watson and Francis Crick marked a milestone in the history of biology and gave rise to modern molecular biology, which is largely concerned with understanding how genes control the chemical processes within cells. In short order, their discovery yielded groundbreaking insights into the genetic code and protein synthesis. During the 1970s and 1980s, it helped to produce new and powerful scientific techniques, specifically recombinant DNA research, genetic engineering, rapid gene sequencing, and monoclonal antibodies, techniques on which today's multi-billion dollar biotechnology industry is founded. Major current advances in science, namely genetic fingerprinting and modern forensics, the mapping of the human genome, and the promise, yet unfulfilled, of gene therapy, all have their origins in Watson and Crick's inspired work. The double helix has not only reshaped biology, it has become a cultural icon, represented in sculpture, visual art, jewelry, and toys. Watson and Crick published their findings in a one-page paper, with the understated title "A Structure for Deoxyribose Nucleic Acid," in the British scientific weekly Nature on April 25, 1953, illustrated with a schematic drawing of the double helix by Crick's wife, Odile. A coin toss decided the order in which they were named as authors. Foremost among the "novel features" of "considerable biological interest" they described was the pairing of the bases on the inside of the two DNA backbones: A=T and C=G. The pairing rule immediately suggested a copying mechanism for DNA: given the sequence of the bases in one strand, that of the other was automatically determined, which meant that when the two chains separated, each served as a template for a complementary new chain. Watson and Crick developed their ideas about genetic replication in a second article in Nature, published on May 30, 1953. DNA is a polymer. The monomer units of DNA are nucleotides, and the polymer is known as a "polynucleotide." Each nucleotide consists of a 5-carbon sugar (deoxyribose), a nitrogen containing base attached to the sugar, and a phosphate group. There are four different types of nucleotides found in DNA, differing only in the nitrogenous base. The four nucleotides are given one letter abbreviations as shorthand for the four bases. A is for adenine G is for guanine C is for cytosine T is for thymine 15 Purine Bases Adenine and guanine are purines. Purines are the larger of the two types of bases found in DNA. Structures are shown below: Structure of A and G Pyrimidine Bases Cytosine and thymine are pyrimidines. The 6 stoms (4 carbon, 2 nitrogen) are numbered 1-6. Like purines, all pyrimidine ring atoms lie in the same plane. Structure of C and T 16 Base Pairs Within the DNA double helix, A forms 2 hydrogen bonds with T on the opposite strand, and G forms 3 hydrogen bonds with C on the opposite strand. Example of dA-dT base pair as found within DNA double helix Example of dG-dC base pair as found within DNA double helix   dA-dT and dG-dC base pairs are the same length, and occupy the same space within a DNA double helix. Therefore the DNA molecule has a uniform diameter. dA-dT and dG-dC base pairs can occur in any order within DNA molecules 17 Exercise I: DNA model building Work in a group of 2-4 students per group. Each group will construct a 9 rung DNA model. Material: Collect following components: Pyrimidines: 4 cytosine (C) Blue 5 Thymine (T) Green Purines: 4 Guanine (G) Orange 5 Adenine (A) Yellow 20 Phosphates white tubes 9 hydrogen bonds white rods 18 deoxyribose sugar black pentagon What are the molecular components present in a nucleotide? Answer: ---------------------------------------------------------------------------------------Step 1: Build 18 nucleotides: 4 each of Cytosine (C) and Guanine (G) 5 each of Adenine (A) and Thymine (T) Step 2: Use these nucleotide units to construct a 9 rung (GATTACACG) DNA strand by connecting them through phosphodiester bonds. Write complimentary DNA strand: -------------------------------------------------------Step 3: Construct complimentary DNA strand as you have written above. You need to connect nucleotides by phosphodiester bond as you have done in step 2. Step 4: Connect two polynucleotide strands now using white color rods (hydrogen bonds. Check double stranded DNA now if A-T and G-C base pair rule is followed or not. Show your instructor the double stranded DNA for accuracy. Exercise 2: DNA replication. The double helix is unwound and each strand acts as a template for the next strand. Bases are matched to synthesize the new partner strands. DNA replication is the process of producing two identical replicas from one original DNA molecule. Step 1: Build 18 more nucleotides of DNA (four C and G; five A and T. DO NOT MAKE A SECOND DNA LADDER. Step 2: Unzip the DNA ladder at week hydrogen bonds. Which area of this DNA is preferred to be unzipped? Write down below DNA ladder that you have constructed in exercise 1 and circle preferred area for unzipping. ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ 18 Step 3. Unzip DNA at preferred area (one base at a time) and bring new nucleotide complimentary to the “old” strand. Continue to connect complimentary nucleotides in both direction to the end. Step 4: Compare both double stranded DNA ladders. Is there any difference in base sequence of both DNA ladders? Circle one: Yes or No You now have two identical models: one half of each model is old and one half is newly formed. This process of DNA replication is called semi-conservative model of DNA synthesis. This is the way DNA is copied prior to cell division and maintain identical base sequence of DNA in daughter cells. Define semiconservative model of DNA synthesis. ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Exercise 3. Transcription is the process of making a RNA copy of a gene sequence. Amino acid coding RNA called a messenger RNA (mRNA) molecule in eukaryotes leaves the cell nucleus and enters the cytoplasm, where it directs the synthesis of the protein. List Differences between DNA and RNA: ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------Material: Collect following components: Pyrimidines: cytosine (C) Blue Uracil (U) Lavender tube Purines: Adenine (A) Orange Guanine (G) Yellow Phosphates white tubes Hydrogen bonds white rods Ribose sugar purple pentagon Ribosome tRNA Peptide bond 19 Amino acids Procedure: Step 1: Start with 9 rung DNA “ladder” as GATTACACG CTAATGTGC template strand Using your desk top to simulate a cell, place the DNA on a portion of the desk top chosen as the nucleus and marked with chalk or a piece of tape, the rest of your desk can be the cytoplasm of the cell. Place the ribosome, transfer RNAs and amino acids in the cytoplasm. Step 2: Construct nine mRNA nucleotides which will be complimentary to the “sense” strand of DNA. Remember that if DNA has adenine, it must match with uracil in RNA. Step 3: Unzip the DNA strand model Step 4: Bond the mRNA nucleotides with their partners of the DNA and to each adjoining mRNA between the sugar of one and the phosphate of the next in the line. GAUUACACG CTAATGTGC Step 5: Unzip the mRNA at the hydrogen bonds. You can zip DNA strand with its complimentary strand. Step 6: Take the “free” mRNA molecule from the nucleus. Exercise 4. Translation is the process of translating the sequence of a messenger RNA (mRNA) molecule to a sequence of amino acids during protein synthesis. The genetic code describes the relationship between the sequence of base pairs in a gene and the corresponding amino acid sequence that it encodes. In the cell cytoplasm, the ribosome reads the sequence of the mRNA in groups of three bases to assemble the protein. Fill in the blanks: Genetic code of triplets of bases are present on ----------------------. Anti-codons of triplets of bases are present on ---------------------------. Procedure Step 1: Place on the ribosome in the cytoplasm. This will be the site of protein synthesis. Step 2.Construct the tRNA molecules by matching three bases that are complimentary to the bases of a codon on the mRNA. Step 3: Find the amino acids with the specific R- groups that matches each tRNA. Step 4: Attach the tRNAs to the R-groups of their specific amino acids. Step 5: Bring the tRNA-amino acid complex to the codon of mRNA which codes for that tRNA. Attach the hydrogen bonds. Step 6: Attach covalent (peptide) bonds (grey tubes) between adjoining amino acids. These peptide bonds are formed through a series of dehydration reactions. Step 7: Disconnect the polypeptide (amino acid chain) from the tRNAs. The polypeptide chain will then coil or fold. 20 Step 8: The tRNAs are then disconnected from the mRNA. Both are now available to be used again in the cytoplasm. Post-lab questions: 1. Compare your DNA and RNA models in relation to the phosphates, sugars and bases. ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------2. Compare general appearance of DNA and RNA model. --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------3. What is produced in: Replication: -------------------------------------------------------------------------------Transcription: ----------------------------------------------------------------------------Translation: -------------------------------------------------------------------------------4. If TAC is the codon in DNA, what is the complimentary code of mRNA? -----------------------5. If mRNA codons are AUG, GGU, CAG, what three codons of tRNA will attach to them? 6. What is the source of free amino acids in the cytoplasm? 7. If the DNA analysis of gene shows 23% adenine, what would be the percentage of: Thymine -------------------------Cytosine -------------------------Guanine -------------------------8. List by order (large to small) of size of the following: cell, gene, chromosome, atom, nucleus, nitrogen base, nucleotide, nucleoside. -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------9. Predict the consequence of a mutation (AAA to TAA) in a gene in relation to product (protein) of this gene. ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 21 Laboratory 3: Isolation of genomic DNA from onion cells estimation of DNA Objective *Describe physical property of DNA *Describe chemical composition of DNA * Explain importance of compartmentalization and location of DNA *List different eukaryotic cellular organelles containing DNA *Learn purpose of each step of DNA isolation. A. Isolation of genomic DNA from onion cells Principle: In eukaryotic cells chromosomal DNAs are double-stranded molecules localized in the nucleus. Chromosomal DNA molecules are complexed with histone proteins as nucleosome. In addition to the nucleus, the mitochondria and chloroplast contain DNA, but not complexed with histone. Isolation of genomic DNA is extremely important to study the structure of gene in the chromosome, regulation of gene expression, and identification of mutation(s) in genes of interest in genetic diseases. Chromosomal DNA in mammalian cells is released from the nucleus by lysis of the plasma and nuclear membranes with solution containing detergent sodium dodecyl sulfate (SDS). Proteins present in the lysate are denatured by chloroform extraction. Genomic DNA is precipitated by adding ethyl alcohol. Precipitated chromosomal DNA is then separated from RNA and picked up from solution. 22 Materials. Homogenizer Glass rod Pipette Conical flask 250 ml (15) Pipette aid Ethyl alcohol Onion Chloroform Cuvette Homogenizing solution (PBS, 0.1 M citrate, 1% SDS) Kim wipe Water bath 65oC Cheese cloth Protein solution (1% BSA) DNA solution Spectrophotometer Glass rod Pre-lab study 1. Name different types of deoxynucleotides present in a DNA molecule. 2. List chemical components present in a nucleotide. 23 Ice box 3. What is function of the following chemicals in DNA isolation: Sodium dodecylsulphate (SDS). Ethyl alcohol. Chloroform 4. Write down the major steps involved in isolation of DNA from eukaryotic cells. Experimental protocol: Work in group (your instructor will determine the number of students per group). Use gloves during DNA isolation procedure Follow instruction precisely to avoid unwanted degradation of chromosomal DNA. Keep a bottle of 250 ml 95% ethanol on ice. Isolation of DNA from onion cell consist of three basic steps: Homogenization: Breaks cell wall, plasma membrane, and nuclear membrane. Deproteinization: Releases chromosomal protein (eg. Histone) from DNA molecules. Precipitation of DNA. Water of hydration is removed from the DNA molecule. DNA cannot stay in solution and precipitate out. 24 Step I: Homogenization 1. Take fresh 50 g onion and make slices of 1-2 mm pieces. 2. Obtain a mass of 20 g fresh sliced onion in a 250 ml conical flask. 3. Add 100 ml homogenizing solution. 4. Mix thoroughly and incubate the flask at 65oC for 15 minutes What happens at this stage by: Heat (65oC): soften onion tissues, loosen cells, denature enzymes. SDS: dissolves membranes, and denatures protein. 5. Incubate the flask in ice bath (pieces of ice in water) to lower temperature to 20oC. 6. Pour cooled onion slice preparation in a blender and fasten the lid. Homogenize for 30 seconds at low speed, followed by 30 seconds at high speed. What happens by: Homogenization: --------------------------------------------------------------------------------------------------------------------------------------Na-citrate: --------------------------------------------------------------------------------------------------------------------------------------------------. 7. Pour homogenate from the blender and keep on ice for 10 minutes. 25 8. Filter the homogenate through four layer thickness cheesecloth into a clean 250 ml beaker. Keep filtrate on ice. Where do you think most of the onion DNA is present? Filtrate or material retained on cheesecloth. Step II. De-proteinization 9. Transfer 50 ml of filtrate into a clean 250 ml conical flask. 10. Add 10 ml chloroform into the conical flask. You should see a layer of chloroform separated from the homogenate at the bottom of the flask. 11. Gently swirl the content of the flask a few times. DO NOT VIGOROUSLY MIX SOLUTION. What happens at this stage ? ------------------------------------------------------------------------------------------------------------------------------------------------------- 26 12. Carefully collect homogenate (aqueous layer) into another clean 250 ml conical flask. Make sure that none of the chloroform and protein precipitate contaminates aqueous layer. 13. Repeat steps 10-12 to remove more of the biomolecules other than nucleic acid from the aqueous layer. Take aqueous layer in a clean 250 ml conical flask. Where is onion DNA present now? Circle appropriate words below. Aqueous layer Chloroform layer Step III Precipitation of DNA 14. Place conical flask containing aqueous layer on ice for 5-10 minutes. 15. Slowly add 80 ml of ice cold 95% ethanol down the side of the wall of conical flask. You may not need to add all of 80 ml of cold 95% ethanol to precipitate DNA. 16. Gently mix ethanol with aqueous solution. You will find stringy DNA precipitate appears. 17. Using a glass rod, spool out stringy DNA onto glass rod by rotating glass rod in one direction. Rotating in one direction reduces physical damage/break long DNA molecules. 18. Transfer DNA into a 1.5 ml tube. 27 19. Air dry DNA for 5-10 minutes. 20. Dissolve DNA in appropriate volume of TE buffer (10 ml, consult with your instructor). Close cap of the tube and store at -20oC for future use. B. Spectrophotometric determination of DNA concentration Spectrophotometry is the quantitative estimation of the reflection or transmission light passing through a solution. A spectrophotometer is an instrument employed to measure the proportionate amount of light of different wavelengths absorbed or transmitted by a chromophore in solution. A molecule or group of molecules usually absorbs light in a unique pattern. This absorption pattern (maxima) can be used for characterization and estimation of molecules. Nucleic acids absorb maximum light at 260 nm while absorption maxima of protein is at 280 nm. The quality and concentration of DNA can be determined by taking absorption of sample at 280 nm. The higher the ratio of the absorbance at 260 nm to the 280 nm (A260 nm/280 nm) the higher the DNA content. You will work in teams (as your instructor directs) to obtain data in this experiment. Materials Cuvettes TE DNA solution Protein solution (mg/ml) Kim wipes 250 ml beaker 28 Procedure 1. Turn on spectrophotometer (Spectronic 20) at least before starting use. 2. Each team should fill two third of each cuvette with: A. TE (control), B. DNA solution, and C. protein solution. 3. Take the cuvette containing TE and close sample holder cover. 4. Adjust absorbance to “zero” in Spectrophotometer at 260 nm. 5. Replace TE cuvette with cuvette containing DNA solution. 6. Determine absorption of DNA solution at 160 nm. If absorption at 160 is “off scale”, dilute sample appropriately to have absorption within limit. 7. Select starting wavelength using knob ( ?) to 220 nm. Determine absorption at 220 nm and enter in the Table below. 8. Using the wavelength knob, increase wavelength of 10 nm each time upto 300 nm and record each result in the Table. 9. Replace DNA cuvette with a solution containing protein. 10. Follow the steps from 6 to 8 and enter results in Table below. 11. Draw graph of absorption spectrum for DNA and protein. 29 Table IV. Absorption of different wavelength of light by DNA and protein. Wavelength (nm) Absorption Protein DNA 220 230 240 250 260 270 280 290 300 30 Post lab questions 1. Define dependent and independent variable. 2. Values of dependent variable is plotted in the ------ axis and values independent variable is plotted in the ----- axis. 3. Write down the absorption maxima of: A) DNA: B) RNA: C) Protein: 31 4. What is the function of cuvette with TE solution. 5. Draw and label the structure of a nucleosome. 6. What did you learn about the properties of DNA when you have isolated DNA from onion? 7. What structural property allowed DNA, but not RNA to be spooled out by a glass rod? 8. What is the function of ethyl alcohol? 9. List three important uses of genomic DNA in the laboratory. 10. You are asked to determine DNA content of a liver tissue. Describe how you will proceed in finding amount of DNA in the sample. 32 Lab. 4 Agarose gel electrophoresis: preparation and loading DNA samples Principle: Agarose gel electrophoresis is a technique widely used to separate molecules based upon their charge, size and shape. It is particularly useful in separating charged biomolecules such as DNA, RNA and protein. Molecules having a net negative charge migrate towards the positive electrode (anode) while the net positively charged molecules migrate towards the negative electrode (cathode). The buffer serves as a conductor of electricity and to control the pH. Smaller molecules move through the pores more easily than larger ones. Hypothesis Direction of migration of molecules in an electrical field is determined by its charge. Prediction Negative charged molecules will move toward anode (positively charged) electrode and positively charged molecules will move toward cathode (negatively charged) electrode. Pre-lab questions 1. Define electrophoresis. 2. List three key characteristics of DNA used in studying DNA in electrophoresis. 33 3. Why do you need to use a buffer while studying DNA by electrophoresis ? 4. What is the net charge of DNA at physiological pH (7.4)? 5. Which chemical entity of DNA (deoxynucleotide) is responsible for developing this net charge of DNA? 6. Circle the appropriate word below. DNA in an electrical field will move toward: Positive electrode Negative electrode 7. Describe unique characteristics of agarose used in electrophoresis 34 Material Gel tray Comb Agarose Running chamber with electrode power supply, TBE buffer Globes micropipette Distilled water Micropipette tips Graduated cylinder (1 L) Waste bin Graduated cylinder (100 ml) 1.5 ml tubes and racks camera solutions Conical flask (250 ml) Weighing boat 35 Microwave oven Rainbow colored Procedure: Step I: Preparation of agarose gel (1%): 1. Weigh 1.0 g agarose powder in a conical flask (250 ml capacity). 2. Add 100 ml TBE (Trisma-Borate-EDTA) buffer into the conical flask. 3. Heat (~90oC) agarose suspension until it dissolves completely (do not touch conical flask without gloves. You may burn your hand) 4. Cool agarose solution to 55oC . 5. Make a set up for electrophoresis plate. 6. Pour appropriate amount of agarose solution into the electrophoresis plate. 7. Leave the plate at room temperature until agarose is solidified. Do not disturb electrophoresis plate while gel is solidifying. Well 36 B. Loading (pipetting) samples into the gel: 1. Set micropipette (p20) to 10 µL and attach a yellow tip. 2. Practice transferring 10 µL water three times (each student). 3. Place agarose gel (you prepared) in an electrophoresis chamber. 4. Add enough TBE buffer (1 mm above gel surface) to fully submerge the loading wells in pipetting station. 5. Remove comb carefully and gently (do not break gel) 6. This stimulates an agarose gel in an electrophoresis chamber fill with TBE buffer. 7. Load each type of 10 ul dye in designated well. C. Electrophoresis: 1. Close electrophoresis chamber. 2. Run the gel at 100 v and observe the direction of dye movement. 3. Let run the from most dye travel about 60% of the gel. 4. Stop electrophoresis by disconnecting electric cord from outlet. 5. Open electrophoresis chamber and study gel. 37 Post-lab questions 1. What is the principle of electrophoresis. 2. Draw a picture of gel with labeling. Show positive and negative electrode. Using letters “a, b, c, ---“indicate each type of colored molecules on gel picture. 3. Which molecules are negatively charged? 4. Which molecules are positively charged? 38 Lab 5-7 Project 1: Molecular Cloning of Gene into Plasmid Vector: Restriction digestion When a population of cells is prepared by growth from a single cell, all the cells in the population will be genetically identical. Such a population is called clonal. The process of creating a clonal population is called cloning. The word “cloning” is commonly used to indicate a technique to produce a large number of identical biological entity. DNA cloning involves the use of manipulating DNA to produce multiple copies of the identical DNA. Gene cloning requires a vector (usually plasmid) and gene (DNA) of interest. A plasmid vector (Fig. below) is a small piece of DNA and usually have an origin of replication, restriction endonuclease site, and a selection marker (antibiotic resistant gene). For cloning purposes, plasmid and insertion DNA are cut with a restriction endonuclease to produce DNA ends. Attachment of the insert DNA fragment into the plasmid cloning vector is carried out by a process called “ligation” using DNA ligase. Ligated DNA (called recombinant DNA) is then introduced into E. coli cells by a process called transformation. While bacterial cell increase in number, the recombinant DNA also increase in number. Recombinant DNA is then isolated in large amount from bacteria and characterized. 39 Molecular cloning of DNA/gene involves the following main steps: A. Restriction digestion of plasmid vector and insert DNA. Steps: 1. Your instructor has taken two tubes Labeled “I” (for insert) and “P” (for plasmid). 2. Instructor has also added distilled water and restriction endonuclease buffer as shown in Table below. 3. You will add Plasmid solution, insert DNA solution, and restriction endonuclease (EcoRI) as shown in Table below: Table V. Summary of the volume of chemicals to be added in experimental tube (restriction endonuclease digestion). I P Instructor H2O 23 23 3 3 2 0 Insert 0 2 EcoRI 2 2 added Buffer Plasmid You add 5. Mix solution by tapering with finger. 6. Spin down (1000 rpm, 10 second) solution to bottom of the tube. 7. Incubate tubes at 37oC for 60 minutes. 40 B. DNA ligation: DNA ligation is a method of sealing two fragments of DNA. The process usually performed by using an enzyme called DNA ligase. DNA pieces can be from either from same or different sources. This very important technique used is genetic engineering. For ligation of plasmid and insert DNA, transfer appropriate amount of the DNAs in a sterile 1.5 ml microfuge tubes (cloning sample tube “S” and control tube “C”) as indicated in Table below. Table VI. Summary of the volume of chemicals to be added in experimental tube (ligation). Reagent Tube “S” Tube”C” Plasmid/Eco RI 2 2 Insert/Eco RI 2 0 10X Ligase buffer 2 2 Dist. water 10 12 Ligase (0.5 unit/ul) 2 2 Incubate tubes at 4oC overnight. 41 C. Transformation of E. coli with recombinant plasmid DNA Objective 1. Demonstrate successful transformation genetic material into Bacteria. 2. Determine the degree of success to genetically alter an organism. Introduction Genetic transformation occurs when a cell takes up (takes inside) and expresses a new piece of genetic material—DNA. This new genetic information often provides the organism with a new trait which is identifiable after transformation. A gene is a piece of DNA which provides the instructions for making (codes for) a protein. This protein gives an organism a particular trait/characteristics.Genetic transformation literally means change caused by genes and involves the insertion of one or more gene(s) into an organism in order to change the organism’s traits. Genetic transformation is used in many areas of biotechnology. In agriculture, genes coding for traits such as frost, pest, or drought resistance can be genetically transformed into plants. In bioremediation, bacteria can be genetically transformed with genes enabling them to digest oil spills. In medicine, diseases caused by defective genes are beginning to be treated by gene therapy; that is, by genetically transforming a sick person’s cells with healthy copies of the defective gene that causes their disease. Genes can be cut out of human, animal, or plant DNA and placed inside bacteria. For example, a healthy human gene for the hormone insulin can be put into bacteria. Under the right conditions, these bacteria can make authentic human insulin. This insulin can then be used to treat patients with the genetic disease, diabetes, because their insulin genes do not function normally. 42 In this lab you will perform a procedure known as genetic transformation. Genetic transformation literally means “change caused by genes,” and involves the insertion of a gene into an organism in order to change the organism’s trait. You will use a procedure to transform bacteria with a gene that codes for Green Fluorescent Protein (GFP). The real-life source of this gene is the bioluminescent jellyfish Aequorea victoria. Green Fluorescent Protein causes the jellyfish to fluoresce and glow in the dark. Following the transformation procedure, the bacteria express their newly acquired jellyfish gene and produce the fluorescent protein, which causes them to glow a brilliant green color under ultraviolet light. In this activity, you will learn about the process of moving genes from one organism to another with the aid of a plasmid. In addition to one large chromosome, bacteria naturally contain one or more small circular pieces of DNA called plasmids. Plasmid DNA usually contains genes for one or more traits that may be beneficial to bacterial survival. In nature, bacteria can transfer plasmids back and forth allowing them to share these beneficial genes. This natural mechanism allows bacteria to adapt to new environments. The recent occurrence of bacterial resistance to antibiotics is due to the transmission of plasmids. pGLO plasmid encodes the gene for GFP and a gene for resistance to the antibiotic ampicillin. pGLO also incorporates a special gene regulation system, which can be used to control expression of the fluorescent protein in transformed cells. The gene for GFP can be switched on in transformed cells by adding the sugar arabinose to the cells’ nutrient medium. Selection for cells that have been transformed with pGLO DNA is accomplished by growth on ampillicin plates. Transformed cells will appear white (wild-type phenotype) on plates not containing arabinose, and fluorescent green under UV light when arabinose is included in the nutrient agar medium. 43 Pre-lab questions: 1. It is possible to transform an oorganism? Which Organism is most appropriate ? 2. How can you confirm that organism has been genetically transformed? 3. Predict the effect of ampicillin on the transformed and non-transformed E. coli cells? 4. What is the function of CaCl2 on E coli cells? 5. Define competent cells. 6.What is the function of heat shock during transformation? 7. On which of the plates would you expect to find bacteria most like the original non-transformed E. coli colonies you initially observed? Explain your predictions. 44 8. If there are any genetically transformed bacterial cells, on which plate(s) would they most likely be located? Explain your predictions. Material 1. E. coli starter plate 11. LB nutrient broth 1 2. Poured agar plates (1 LB, 2 LB/amp, 1 LB/amp/ara) per group 3. Transformation solution (CaCl2) 12. Inoculation loops 4. Foam microcentrifuge tube holder/float 13. Pipets 5. Crushed ice (not cubed ice) 14. Marking pen 6. Microcentrifuge tubes 15. Microcentrifuge 7. Micropipettes and tips 16. Gloves 8. Waste disposal bin 17. pGLO plasmid solution (1 ng/µl) 9. 42°C water bath 18. UV Light 10. 37°C incubator Procedure 1. Label one closed micro test tube +pGLO and another -pGLO. Label both tubes with your group’s name. Place them in the foam tube rack. 2. Open the tubes and, using a sterile transfer pipet, transfer 250 µl of transformation solution (CaCl2 ) into each tube. 45 4. Place the tubes on ice for 2 minutes. 4. Use a sterile loop to pick up 4 -8 large colonies of fresh bacteria from your starter plate. Pick up the +pGLO tube and immerse the loop into the transformation solution at the bottom of the tube. Spin the loop between your index finger and thumb until the entire colony is dispersed in the transformation solution (with no floating chunks). Place the tube back in the tube rack in the ice. 5. Using a new sterile loop, repeat for the -pGLO tube. 46 6. Examine the pGLO DNA solution with the UV lamp. Pipet 10 µl of pGLO plasmid into the +pGLO tube & mix. (Do not add plasmid DNA to the -pGLO tube. Close both the + pGLO and pGLO tubes and return them to the rack on ice.). 7. Incubate the tubes on ice for 10 min. Make sure to push the tubes all the way down in the rack so the bottom of the tubes stick out and make contact with the ice. 8. While the tubes are sitting on ice, label your four LB nutrient agar plates on the bottom (not the lid) as follows: Label the LB plate: pGLO-, Label one LB/amp plate: Amp/pGLO,Label the other LB/amp plate: Amp/pGLO+, Label the LB/amp/ara plate: AMP/Ara/pGLO +, 9. Heat shock. Using the foam rack as a holder, transfer both the (+) pGLO and (-) pGLO tubes into the water bath, set at 40o C, for 30 sec. 10. When the 30 sec are done, place both tubes back on ice for 2 min. 47 11. Remove the rack containing the tubes from the ice and place on the bench top. 12. Open a tube and add 250 µl of LB nutrient broth to the tube and reclose it. 13. Repeat with a new sterile pipet for the other tube. Incubate the tubes for 10 min at room temperature. 14. Gently flick the closed tubes with your finger to mix and resuspend the bacteria. 15. Using a new sterile pipet for each tube, pipet 100 µl of the transformation and control suspensions onto the appropriate nutrient agar plates. 16. Use a new sterile loop for each plate. Spread the suspensions evenly around the surface of the LB nutrient agar by quickly skating the flat surface of a new sterile loop back and forth across the plate surface. 48 17. Stack up your plates and tape them together. Put your group name and class period on the bottom of the stack and place the stack of plates upside down in the 37°C incubator until the next day. The plates are inverted to prevent condensation on the lid which may drip onto the culture and interfere with your results. 49 Results Observe your plate under normal and UV light and record your observation in the table below./ Table VII. Number of transformed E. coli colonies in different plates. Fluorescent Hints: 1. How much bacterial growth do you see on each plate, relatively speaking? 2. What color are the bacteria? 3. How many bacterial colonies are on each plate (count the spots you see). Determine total number of ampicillin resistant colonies: sum of #Amp pGLO +, and pAmp/Ara/pGLO+. Determine average number of colonies per plate = Total number of colonies / 2 50 Transformation efficiency. Qquantitative measurement of genetically modified E. coli cells is referred to as the transformation efficiency. Usually, transformation efficiency is expressed as number of antibiotic resistant colonies appeared per microgram of plasmid DNA. The transformation efficiency is determine how well the E. coli cells are for genetic transformation is working. The transformation efficiency is calculated using the following formula: Transformation efficiency = Total number of colonies growing on the agar plate per µg plasmid DNA. To calculate the efficiency, you will need : The total amount of pGLO plasmid DNA in the bacterial cells spread on each plate. Determining the Total Amount of pGLO plasmid DNA DNA in µg = (concentration of DNA in µg/µl) x (volume of DNA in µl) In this experiment you used 10 µl of pGLO at concentration of 0.001 µg/µl. This means that each microliter of solution contained 0.001 µg of pGLO DNA. Calculate the total amount of DNA used in this experiment. Enter that number here ➜ Total number of ampicillin resistant colonies per plate = Determining the fraction of pGLO plasmid DNA (in the bacteria) that actually got spread onto the LB/amp/ara plate: Volume spread on LB/amp plate: 100 (µl) Total sample volume in test tube: 510 (µl) 51 pGLO DNA spread in µg = Total amount of DNA used in µg x fraction of DNA used Transformation efficiency = Total average number of colonies growing on the agar plate / pGLO DNA used in µg. (usually expressed number of colonies/µg plasmid DNA. Enter transformation efficiency of each group in the Table. Table VIII. Transformation efficiency competent cells prepared by different groups. Group Name Transformation efficiency 52 Post lab questions 1. Which plates should be compared to determine if any genetic transformation has occurred? Why? 2. What is meant by a control plate? What purpose does a control serve? 3. What’s Glowing in E. coli cell when exposed to UV light? 4. What is the function of Arabinose? 5. What is the transformation efficiency of your competent E. coli cell? 6. Scientists prepare competent E. coli cells having a transformation efficiency of about 108 cells/ug plasmid DNA. Compare your competent E. coli cells with those prepared by scientists. 7. Calculate % score of your E. coli transformation efficiency (T.E.). Your T.E. % score = ------------------------------------------- X 100 T.E. of professionals (108) 53 Commonly used reagents and terms: 1. Agar: A gelatinous substance derived from seaweed. Provides a solid Matrix below 55oC to support bacterial growth. Agar becomes liquid above 55oC. This is a very useful characteristic of agar to be used in scientific experiments. 2. Antibiotic Selection: Use of an antibiotic to select bacteria containing the DNA of interest. The pGLO plasmid DNA contains the gene for beta-lactamase that provides resistance to the antibiotic ampicillin. Once bacteria aretransformed with the pGLO plasmid, they begin producing and secreting beta-lactamase protein. Secreted beta-lactamase breaks down ampicillin, rendering the antibiotic harmless to the bacterial host. Only bacteria containing the pGLO plasmid can grow and form colonies in nutrient medium containing ampicillin, while untransformed cells that have not taken up the pGLO plasmid cannot grow on the ampicillin selection plates. 2. Arabinose: A carbohydrate isolated from plants that is normally used as source of food by bacteria. In this experiment, arabinose initiates transcription of the GFP gene resulting in fluorescent green cells under UV light. 3. Colony: A clump of genetically identical bacterial cells growing on an agar plate. Because all the cells in a single colony are genetically identical, they are called clones. 4. Culture Media: The liquid and solid media referred to as LB (named after Luria and Bertani) broth and agar are made from an extract of yeast and an enzymatic digest of meat byproducts which provide a mixture of carbohydrates, amino acids, nucleotides, salts, and vitamins, all of which are nutrients for bacterial growth. Agar, which is from seaweed, polymerizes when heated and cooled to form a solid gel (similar to Jell-O gelatin), and functions to provide a solid support on which to culture the bacteria. 5. Genetic Engineering. The manipulation of an organism’s genetic material (DNA) by introducing or eliminating specific genes. 6. Gene Regulation. Gene expression in all organisms is carefully regulated to allow for differing conditions and to prevent wastefuloverproduction of unneeded proteins. The genes involved in the transport and breakdown of food are good examples of highly regulated genes. For example, the simple sugar, 54 arabinose, can be used as a source of energy and carbon by bacteria. The bacterial enzymes that are needed to break down or digest arabinose for food are only expressed in the absence of arabinose but are expressed when arabinose is present in the environment. In other words when arabinose is around, the genes for these digestive enzymes are turned on. When arabinose runs out these genes are turned back off. 7. Fluorescent Protein gene. Green Fluorescent Protein Green Fluorescent Protein (GFP) was originally isolated from the bioluminescent jellyfish, Aequorea victoria. The gene for GFP has recently been cloned. The unique three-dimensional conformation of GFP causes it to resonate when exposed to ultraviolet light and give off energy in the form of visible green light. When exposed to UV light, the electrons in GFP's chromophore are excited to a higher energy state. When they drop down to a lower energy state, they emit a longer wavelength of visible fluorescent green light at ~509 nm. 8. Plasmid. A circular DNA molecule, capable of self-replicating, carrying one or more genes for antibiotic resistance proteins and a cloned foreign gene such as GFP. It is an extra-chromosomal DNA molecule separate from the chromosomal DNA. Plasmids usually occur naturally in bacteria. 9. pGLO Plasmid containing the Green Fluorescent Protein gene sequence and ampicillin resistance gene, which codes for beta-lactamase. 10. Recombinant DNA technology. The process of cutting and recombining DNA fragments. Technology as a means to isolate genes or to alter their structure and function. 55 D. Isolation of Plasmid DNA from transformed E. coli cells A plasmid is a DNA molecule that is separate from, and can replicate independently of, the chromosomal DNA. They are double-stranded and, in many cases, circular. Plasmids usually occur naturally in bacteria, but are sometimes found in eukaryotic organisms (e.g., the 2micrometre ring in Saccharomyces cerevisiae). Plasmid sizes vary from 1 to over 1,000 kbp. The number of identical plasmids in a single cell can range anywhere from one to even thousands under some circumstances. Plasmids can be considered mobile because they are often associated with conjugation, a mechanism of horizontal gene transfer. The term plasmid was first introduced by the American molecular biologist Joshua Lederberg in 1952. Plasmids are considered replicons, capable of replicating autonomously within a suitable host. Plasmids can be found in all three major domains: Archaea, Bacteria, and Eukarya. Plasmids used in genetic engineering are called vectors. Plasmids serve as important tools in genetics and biotechnology labs, where they are commonly used to multiply (make many copies of) or express particular genes. Many plasmids are commercially available for such uses. The gene to be replicated is inserted into copies of a plasmid containing genes that make cells resistant to particular antibiotics and a multiple cloning site (MCS, or polylinker), which is a short region containing several commonly used restriction sites allowing the easy insertion of DNA fragments at this location. 56 In this laboratory, plasmid DNA will be purified using a plasmid mini kit is and eluted into a small volume of aqueous buffer and is free of salts, bacterial chromosomal DNA, and RNA. The purity of the plasmid produced by this system makes it ideal for use in automated fluorescent sequencing and in any other molecular biology application. Pre-lab questions: Materials 1. Resuspension solution 7.Microcentrifuge 13. Lysis solution 2. Neutralization solution 8.Wash solution 14. Elution solution 3. plasmid mini columns 9.Gloves 15. Micropipettes 4. 2 ml capless wash tubes 10.Biohazard waste bin 16. LB broth 5. 15 ml sterile tubes 11. Incubator shaker 17. Ethanol 6. Inoculating needle, burner 12. Ampicillin 18. Plasmid isolation kit Pre- lab questions 1. Define a plasmid. 2. List four important characteristics of plasmid DNA. 3. Describe the function of: A. Lysis solution: 57 B. Neutralization solution: C. Wash solution: D. Elution solution: E. Ethanol: Procedure I. Plasmid containing E. coli culture 1. Take 5 ml culture tube. Label your name and #1 and #2. Add 2 ml LB (Luria-Bertani broth) containing 50 µg/ml ampicillin in each tube. 2. Each student will inoculate one ampicillin resistant E. coli colony in each of 15 ml culture tube. YOUR INSTRUCTOR WILL SHOW HOW TO INOCULATE E. COLI. 3. Incubate tubes in a incubator shaker overnight at 37oC. II. Plasmid isolation 1. Transfer up to 1.5 ml of plasmid-containing bacterial host to a 1.5–2.0 ml 58 capped microcentrifuge tube. Pellet the cells by centrifugation at 12 krpm for 3 min. Remove all supernatant by decanting or pipetting. 2. Add 250 µl of resuspension solution and vortex or pipet up and down until the cell pellet is completely resuspended. 3. Add 250 µl of lysis solution and mix by inverting the capped tube briskly 6–8 times. DO NOT VORTEX OR SHAKE. The solution should become viscous and slightly clear. Note: The neutralization solution should be added within 5 min after lysis. 4. Add 350 µl of neutralization solution and mix by inverting the capped tube briskly 6–8 times. DO NOT VORTEX OR SHAKE. A visible precipitate should form. 5. Centrifuge the neutralized lysate at 12 krpm for 5 min. A compact white debris pellet will form along the side or at the bottom of the tube. The supernatant or cleared lysate contains the plasmid DNA. 6. While centrifuging the lysate, insert a plasmid mini column into a 2 ml capless wash tube (provided). 7. By decanting or pipetting, transfer the cleared lysate from step 5 to the plasmid mini column. Centrifuge at 12 krpm for 1 min. 8. The wash solution is supplied as a 5x concentrate. Add 4 volumes (100 ml) of 95–100% ethanol or reagent-grade (denatured) ethanol before initial use. Your instructor will add ethanol to prepare 1X wash buffer. 9. Remove the plasmid mini column from the wash tube. Discard the filtrate from the tube, and replace the column into the same wash tube. Add 750 µl 59 of wash solution and centrifuge at 12 krpm for 1 min. 10. Discard the wash solution from the tube, and replace the column into the same wash tube. Centrifuge at 12 krpm for 1 additional minute to remove residual wash solution. 11. Transfer the plasmid mini column to a 1.5–2.0 ml capped microcentrifuge tube.. Add 50 µl of elution solution onto the membrane stack at the base of the column and allow 2 min for the solution to saturate the membranes. Centrifuge for 1 min to elute the plasmid. 11. Discard the mini column and store the eluted DNA at 4ºC. Plasmid DNA is ready for use. 60 E. Restriction Mapping of Plasmid DNA A restriction map is a description of restriction endonuclease cleavage sites within a piece of DNA. Generating such a map is usually the first step in characterizing an unknown DNA, and a prerequisite to manipulating it for other study. Restriction mapping involves digesting DNA with a series of restriction enzymes and then separating the resultant DNA fragments by agarose gel electrophoresis. The distance between restriction enzyme sites can be determined by the patterns of fragments that are produced by the restriction enzyme digestion. In this way, information about the structure of an unknown piece of DNA can be obtained. In this experiment, plasmid DNA isolated in previous experiment will be cut with restriction enzymes and the resulting restriction fragments are separated using gel electrophoresis. Three samples of plasmid DNA are incubated at 37°C, each with one of three restriction endonucleases: BamHI, EcoRI, and HindIII. A fourth sample, the negative control, is incubated without an endonuclease. The DNA samples are then loaded into wells of an agarose gel and electrophoresed. An electrical field applied across the gel causes the DNA fragments in the samples to move from their origins (sample wells) through the gel matrix toward the positive electrode. The restriction patterns are made visible by staining with a compound that binds to DNA. 61 Pre-lab study and questions: 1. What is restriction endonuclease ? Study the base of the DNA below. If EcoRI recognizes base sequence of GAATTC, write the DNA fragments (showin base sequence) that will be produced after EcoRI digestion of this DNA. 5’ACGCGAATTGAATTCGATCGAATCCAGTAGCCGCAATTCCAAGAATTCTTC 3’ 3’TGCGCTTAACTTAAGCTAGCTTAGGTCATCGGCGTTAAGGTTCTTAAGAAG 5’ 2. An example of how restriction map is constructed is shown below. You have isolated a clone in pBluescript. Big pBluescript portion of the plasmid is 3.0 kilobases and restriction enzymes are present in the plasmid is known. You also know that the insert is 2.0 kb long and that it is inserted the Eco RI site. Your task is to find out more information about the insert: Digest plasmid with an enzyme that you know is in the pBluescript plasmid. Plasmid DNA was digested with Bam HI and digested DNA fragment were studied by electrophoresis. A picture of gel is shown below: 62 The sizes of the two fragments (determined by electrophoresis) will tell you where the site is. In this case, we learn two pieces of information: 1) that there is a Bam HI site in the insert, and 2) where the site is in relation to the one end of the insert. When the Bam HI digestion is separated on an agarose gel, the sizes of the two fragments can be determined. In the above gel, the fragments are 3.6 kb and 1.4 kb. Therefore, we know that the Bam HI site is 1.4 kb away from the right hand side of the insert below. In this way, you have "mapped" the Bam HI site: 63 Materials 1. Agarose 2. Loading dye 3. TBE buffer 4. 1.5 mL Reaction tubes 5. Gloves 6. Restriction buffer 7. Plasmid DNA 8. Restriction enzymes (BamHI, EcoRI, HindIII) 9. Micropipettors micropipet tips 10. Gel electrophoresis chambers and power supplies. 11. Masking tape for sealing 12. Gel-casting tray 13. Cracked ice 14. Sterile distilled water 15. Ppermanent laboratory markers 16. Microwave oven 17. Water bath at 37°C 19. Metric rulers 20. UV light source 18. Semilog graph paper 21. A Polaroid® “gun” camera or other camera is desirable for recording results. Procedure A: Set Up Restriction Digestion (Students work in group) 1. Label four 1.5-mL tubes, in which they will perform restriction reactions: B for BamHI, E for EcoRI, H for HindIII, and –C for control. One set for “1” One set for “2” 2. Read down each column (Table below), add the same reagent to all appropriate tubes; use a fresh tip for each reagent. 64 Table IX. Summary of the volume of chemicals to be added in different tubes. Tube DNA (clone) Buffer EcoRI BamHI Hind III Water E 8 µL 1 µL 1 µL - - - B 8 µL 1 µL - 1 µL - - H 8 µL 1 µL - - 1 µL - C 8 µL 1 µL - - - 1 µL *All groups share the same BamHI, EcoRI, HindIII enzymes , buffer, and water. 3. Pool reagents and mixed by tapping the tube bottom on lab bench, or with a short pulse in a microcentrifuge. 4. Incubate all reaction tubes for a minimum of 60 minutes at 37°C. You may need to incubate the reactions for a longer period (you’re your instructor asks for). B: Cast Agarose Gel 1. Seal ends of gel-casting tray with tape, and insert well forming comb. Place gelcasting tray out of the way on lab bench, so that agarose poured in next step can set undisturbed. 2. Dissolve 1 g agarose per 100 mL of TBE buffer by heating in a microwave oven. Cool agarose solution (1%) on to about 60oC. 65 3. Carefully pour enough agarose solution into casting tray to fill to a depth of about 7 mm of comb teeth. While gel is still liquid, a pipet tip is used to move large bubbles or solid debris to sides or end of tray. 3. Gel will become cloudy as it solidifies (about 10 minutes). Do not move or jar casting tray while agarose is solidifying. 4. When agarose has set, unseal ends of casting tray and place tray on platform of gel box so that comb is at negative (black) end. 5. Fill box with tris-borate-EDTA (TBE) buffer to a level that just covers entire surface of gel. 6. Gently remove comb, taking care not to rip wells (instructor will demonstrate). 7. Make certain that sample wells left by comb are completely submerged. If “dimples” are noticed around wells, students slowly add buffer until dimples disappear. The gel is now ready to load with DNA. C. Load Gel: 1. Draw a gel showing the samples to be loaded in the specified well as shown below: M Well M: Molecular weight size marker C: Control E: EcoRI digest B: BamHI digest H: Hind III digest 66 C E B H 2. Students add 1 µL loading dye to each reaction tube and mix dye with digested DNA by tapping tube on lab bench, or with a pulse in microcentrifuge. 3. Students use a micropipet to load contents of each reaction tube (11 µL) into a separate well in gel, as shown above. Students must use a fresh tip for each reaction tube. • Steady pipet over well using two hands. *Be careful to expel any air in micropipet tip end before loading gel. • Dip pipet tip through surface of buffer, position it over the well, and slowly expel the mixture. Sucrose in the loading dye weighs down the sample, causing it to sink to the bottom of the well. Be careful not to punch tip of pipet through the bottom of the gel. D. Electrophoresis: 1. Students close top of electrophoresis chamber and connect electrical leads to an approved power supply, anode to anode (red-red) and cathode to cathode (black-black). Make sure both electrodes are connected to same channel of power supply. 2. Students turn power supply on, and set voltage 100 v as directed by the instructor. Shortly after current is applied, loading dye can be seen moving through gel toward positive pole of electrophoresis apparatus. 3. The loading dye (color) will start moving toward anode. Xylene cyanol (a dye) migrates at a rate equivalent to approximately 2000 base pairs while bromophenol blue band moves approximately 500 base pair in a 1% gel. 5. Allow the DNA to electrophorese until the nears the end (~80%) of the gel. 5. Students turn off power supply, disconnect leads from the inputs, and remove top of electrophoresis chamber. 6. Students should carefully remove casting tray and slide gel into staining tray labeled with their group name. The students bring their 67 gels to the instructor for staining. E. Ethidium Bromide Staining : Ethidium bromide, like many natural and man-made substances, is a mutagen and a suspected carcinogen. With responsible handling, the dilute staining solution (1 µg/mL) poses minimal risk: 1. Wear rubber gloves when staining gel, viewing gels, and cleaning up. 2. Confine all staining to sink area restricted from student use. 3. Flood gels with ethidium bromide solution, and allow to stain for 5 minutes. (Staining time depends on thickness of gel.) 4. Following staining, use funnel to decant as much ethidium bromide solution as possible from staining tray back into storage container. F. Record results and analysis. 1. Keep a metric ruler beside the gel. 2. Examine your stained gel on a UV transilluminator. 3. Record gel results by taking a picture. 4. Measure from front edge of well to front edge of each band. Enter distances into matrix. Alternatively, have students measure distance directly from stained gel or from a photo of their ethidium stained gel. 5. Measure distance travelled by each DNA fragment and enter in the Table below. 6. Match base-pair sizes of Hind III fragments with bands that appear in the ideal digest. Label each band with kilobase-pair (kbp) size. For example, 27,491 bp equals 27.5 kbp. 68 7. Set up semilog graph paper with distance migrated as the x (arithmetic) axis and log of base-pair length as the y (logarithmic) axis. Then, plot distance migrated versus base-pair length for each standard size marker DNA. 8. Connect data points with each other. 9. Locate on x axis the distance migrated by the first EcoRI fragment. Using a ruler, draw a vertical line from this point to its intersection with the standard curve. 10. Now extend a horizontal line from this point to the y axis. This gives the base-pair size of this EcoRI fragment. 11. Repeat Steps 9 and 10 for each HindIII and BamHI fragment. 12. Enter the base-pair size of EcoRI, HindIII, and BamHI fragments. Table X. Summary of the DNA fragments characterized by agarose gel electrophoresis. Size Marker EcoRI Distance Distance Size BamHI Size Distance 69 Hind III Size Distance Size 70 Post Lab questions 1. The electrophoresis apparatus creates an electrical field with positive and negative poles at the ends of the gel. DNA molecules are negatively charged. To which electrode pole of the electrophoresis field would you expect DNA to migrate? (+ or -)? Explain. 2. What color represents the negative pole? 3. After DNA samples are loaded into the sample wells, they are “forced” to move through the gel matrix. What size fragments (large vs. small) would you expect to move toward the opposite end of the gel most quickly? Explain. 4. Which fragments (large vs. small) are expected to travel the shortest distance from the well? Explain. 5. . What can you assume is contained within each band? 3. What would be a logical explanation as to why there is more than one band of DNA for each of the samples? 71 4. What caused the DNA to become fragmented? 5. Which sample has the smallest DNA fragment? 7. Assuming a circular piece of DNA (plasmid) was used as starting material, how many restriction sites were there in lane three? 8. What determines where a restriction endonuclease will “cut” a DNA molecule? 9. A restriction endonuclease “cuts” two DNA molecules at the same location. What can you assume is identical about the molecules at that location? 72 Lab 7 and 9 Project 2: Polymerase Chain Reaction: Identification of a specific sequence of DNA in human genome Introduction In 1983, Kary Mullis at Cetus Corporation developed the molecular biology technique that has since revolutionized genetic research, earning him the Nobel Prize in 1993. This technique, termed the polymerase chain reaction (PCR), transformed molecular biology into a multidisciplinary research tool. Many molecular biology techniques used before PCR were labor intensive, time consuming and required a high level of technical expertise. Additionally, working with only trace amounts of DNA made it difficult for researchers in other biological fields (pathology, botany, zoology, pharmacy, etc.) to incorporate molecular biology into their research schemes. PCR had an impact on four main areas of biotechnology: gene mapping, cloning, DNA sequencing, and gene detection. PCR is now used as a medical diagnostic tool to detect specific mutations that may cause genetic disease, in criminal investigations and courts of law to identify suspects on a molecular level, and in the sequencing of the human genome. Prior to PCR the use of molecular biology techniques for therapeutic, forensic, pharmaceutical, or medical diagnostic purposes was not practical or cost-effective. The development of PCR technology changed these aspects of molecular biology from a difficult science to one of the most accessible and widely used tools in genetic and medical research. PCR produces exponentially large amounts of a specific piece of DNA from trace amounts of starting material (template). The template can be any form of double-stranded DNA, such as genomic DNA. A researcher can take trace amounts of DNA from a drop of blood, a single hair follicle, or a cheek cell and use PCR to generate millions of copies of a 73 desired DNA fragment. In theory, only one single template strand is needed to generate millions of new DNA molecules. Prior to PCR, it would have been impossible to do forensic or genetic studies with this small amount of DNA. The ability to amplify the precise sequence of DNA that a researcher wishes to study or manipulate is the true power of PCR. PCR amplification requires the presence of at least one DNA template strand. In this experiment, human genomic DNA isolated from students own cells will be the source of the template strands. One of the main reasons PCR is such a powerful tool is its simplicity and specificity. All that is required are inexpensive reaction buffers, four DNA subunits (deoxynucleotide triphosphates of adenine, guanine, thymine, and cytosine), a DNA polymerase, two DNA primers, and minute quantities of the template strand that one wants to amplify. Specificity comes from the ability to target and amplify one specific segment of DNA out of a complete genome. PCR Makes Use of Two Basic Processes in Molecular Genetics 1. Complementary DNA strand hybridization 2. DNA strand synthesis via DNA polymerase In the case of PCR, complementary strand hybridization takes place when two different oligonucleotide primers anneal to each of their respective complementary base pair sequences on the template. The two primers are designed and synthesized in the laboratory with a specific sequence of nucleotides such that they can anneal at the opposite ends and on the opposite strands of the stretch of double-stranded DNA (template strand) to be amplified. Before a region of DNA can be amplified, one must identify and determine the sequence of a piece of DNA upstream and downstream of the region of interest. These areas are then used to determine the sequence of oligonucleotide primers that will be synthesized and used as 74 starting points for DNA replication. Primers are complimentary to the up- and downstream regions of the sequence to be amplified, so they stick, or anneal, to those regions. Primers are needed because DNA polymerases can only add nucleotides to the end of a preexisting chain. The DNA polymerase used in PCR must be a thermally stable polymerase because the polymerase chain reaction cycles between temperatures of 60°C and 94°C. The thermostable DNA polymerase (Taq) used in PCR was isolated from a thermophilic bacterium, Thermus aquaticus, which lives in high-temperature steam vents such as those found in Yellowstone National Park. Two new template strands are created from the original double-stranded template on each complete cycle of the strand synthesis reaction. This causes exponential growth of the number of template molecules, i.e., the number of DNA strands doubles at each cycle. Therefore, after 30 cycles there will be 230 , or over 1 billion, times more copies than at the beginning. Once the template has been sufficiently amplified, it can be visualized. This allows researchers to determine the presence or absence of the desired PCR products and determine the similarities and differences between the DNA of individuals. Depending on the DNA 75 sequence analyzed, differences among individuals can be as great as hundreds of base pairs or as small as a single base pair or single point mutation. In this activity, students will isolate their own genomic DNA from their cells. They will use primers that flank both the entire Alu insertion (300 base pairs in length) and 641 base pairs of the PV92 locus to amplify a 941 base pair fragment (if the Alu element is present) or a 641 base pair fragment (if the Alu element is absent). Agarose gel electrophoresis of the PCR products is sufficient to distinguish among homozygotes (+/+) for the presence of the Alu repeat (941 base pair product only), homozygotes (–/–) for the absence of the Alu repeat (641 base pair product only), and heterozygotes (+/–) having both the 641 and the 941 base pair products. 76 PCR Step by Step PCR involves a repetitive series of cycles, each of which consists of template denaturation, primer annealing, and extension of the annealed primer by Taq DNA polymerase. The first step of the PCR temperature cycling procedure involves heating the sample to 94°C. At this high temperature, the template strands separate (denature). This is called the denaturation step. In second step thermal cycler then rapidly cools to 60°C to allow the primers to anneal to the separated template strands. This is called the annealing step. The two original template strands may reanneal to each other or compete with the primers for the primers complementary binding sites. However, the primers are added in excess such that the primers actually outcompete the original DNA strands for the primers’ complementary binding sites. In third step, the thermal cycler heats the sample to 72°C for Taq DNA polymerase to extend the primers and make complete copies of each template DNA strand. This is called the extension step. Taq polymerase works most efficiently at this temperature. Two new copies of each complementary strand are created. There are now two sets of double-stranded DNA (dsDNA). These two sets of dsDNA can now be used for another cycle and subsequent strand synthesis. Therefore, if 20 thermal cycles were conducted from one double-stranded DNA molecule, there would be 1 set of original genomic template DNA strands, 20 sets of intermediate template strands, and 1,048,576 sets of precise-length template strands. After 40 cycles, there would be 1 set of original genomic template DNA strands, 40 sets of intermediate template strands, and 1.1 x 1012 sets of precise-length template strands (Figure below). 77 Pre-lab study and questions 1. A single-stranded DNA has a base sequence of 5’ GACTCCGTAACGGTTAACC 3’. Study the DNA sequences shown below that will base pair (hybridize) with this DNA. Circle the correct answer (s). 5’ GACTCCGTAACGGTTAACC 3’ 5’CTGAGGCATTGCCAATTGG 3’ 3’CTGAGGCATTGCCAATTGG 5’ 5’ AGGCATTGCCAATT 3’ 3’ AGGCATTGCCAATT 5’ 2.Why is it necessary to chelate the metal ions from solution during the boiling/lysis step at 100°C? What would happen if you did not use a chelating agent such as the InstaGene matrix? 3. What is needed from the cells for PCR? 4. What structures must be broken to release the DNA from a cell? 5. Why do you think the DNA is stored cold with the InstaGene matrix after boiling the samples? 78 6. Why is it necessary to have a primer on each side of the DNA segment to be amplified? 7. How did Taq DNA polymerase acquire its name? 8. Why are there nucleotides (A, T, G, and C) in the master mix? What are the other components of the master mix, and what are their functions? 9. Describe the three main steps of each cycle of PCR amplification and what reactions occur at each temperature. 10. Explain why the precise length target DNA sequence doesn’t get amplified until the third cycle. You may need to use additional paper and a drawing to explain your answer. 79 Materials A. DNA Template Preparation 1. 1.5 ml micro test tubes 6. Screwcap tubes with InstaGene matrix 3. Foam micro test tube holders 7. Micropipets, tips 4. Permanent marker 8. Waste container 5. Cups with 10 ml 0.9% saline 9. Microcentrifuge 6. Water baths (56 and 100°C) 10. Vortexer B. PCR Amplification 1. PCR tubes 7. Gel trays 2. Complete master mix (containing primers) 8. Molten agarose 3. micro test tube holders 9. Lab tape 4. Ice bucket with ice 10. MyCycler™ thermal cycler 5. Permanent marker 11. Microcentrifuge 6. Waste container 7. Amplified positive control samples PV92 homozygous (+/+) PV92 homozygous (–/–) PV92 heterozygous (+/–) C. Gel Electrophoresis of Amplified PCR Samples and Staining of Agarose Gels 1. Agarose gel 6. Foam micro test tube holders 2. PCR samples 7. Gel box and power supply 3. DNA loading dye 8. Gel staining tray 4. EZ Load™ molecular mass ruler (DNA standards) 5. Permanent marker 9. Waste container 80 10. Microcentrifuge Procedure A. Cheek Cell DNA Template Preparation (Protocol) 1. Each member of your team should have 1 screwcap tube containing 200 µl InstaGene™ matrix, 1.5 ml micro test tube, and a cup containing 10 ml of 0.9% saline solution. Label one of each tube and a cup with your initials. 2. Do not throw away the saline after completing this step. Pour the saline from the cup into your mouth. Rinse vigorously for 30 seconds. Expel the saline back into the cup. 3. Set a P-1000 micropipet to 1,000 µl and transfer 1 ml of your oral rinse into the micro test tube with your initials. If no P-1000 is available, carefully pour ~1 ml of your swished saline into the micro test tube (use the markings on the side of the micro test tube to estimate 1 ml). 4. Spin your tube in a balanced centrifuge for 2 minutes at 10 krpm. When the centrifuge has completely stopped, remove your tube. You should be able to see a pellet of whitish cells at the bottom of the tube. Ideally, the pellet should be about the size of a match head. If you can’t see your pellet, or your pellet is too small, pour off the saline 81 supernatant, add more of your saline rinse, and spin again. 5. Pour off the supernatant and discard. Taking care not to lose your cell pellet, carefully blot your micro test tube on a tissue or paper towel. It’s ok for a small amount of saline (~50 µl, about the same size as your pellet) to remain in the bottom of the tube. 6. Resuspend the pellet thoroughly by vortexing or flicking the tubes until no cell clumps remain. 7. Using an adjustable volume micropipet set to 20 µl, transfer your resuspended cells into the screwcap tube containing the InstaGene with your initials. You may need to use the pipet a few times to transfer all of your cells. 8. Screw the caps tightly on the tubes. Shake or vortex to mix the contents. 9. Place the tubes in the foam micro test-tube holder. When all members of your team have collected their samples, float the holder with tubes in a 56°C water bath for 10 minutes. At the halfway point (5 minutes), shake or vortex the tubes several times. Place the tubes back in the water bath for the remaining 5 minutes. 82 10. Remove the tubes from the water bath and shake them several times. Now float the holder with tubes in a 100°C water bath for 5 minutes. 11. Remove the tubes from the 100°C water bath and shake or vortex several times to resuspend the sample. Place the eight tubes in a balanced arrangement in a centrifuge. Pellet the matrix by spinning for 5 minutes at 6,000 x g (or 10 minutes at 2,000 x g). 12. Store your screwcap tube in the refrigerator until the next laboratory period, or proceed to step 2 of Lesson 2 if your teacher instructs you to do so. B. PCR Amplification (Protocol) 1. Obtain your screwcap tube that contains your genomic DNA template from the refrigerator. Centrifuge your tubes for 2 minutes at 6,000 rpm or for 5 minutes at 3,000 rpm in a centrifuge. 2. Each member of the team should obtain a PCR tube and capless micro test tube. Label each PCR tube on the side of the tube with your initials and place the PCR tube into the capless micro test tube as shown. Place the PCR tube in the foam micro test tube holder. 83 Table XI: Summary of mixing chemicals for PCR Reagent C +/+ +/- -/- V X Y Z Genomic 0 20 20 20 20 20 20 20 Master mix, 20 20 20 20 20 20 20 20 0 0 0 0 0 0 0 DNA, µL µL H2O, µL 20 3. Transfer 20 µl of your DNA template from the supernatant in your screwcap tube into the bottom of the PCR tube. Do not transfer any of the matrix beads into the PCR reaction because they will inhibit the PCR reaction. 84 4. Locate the tube of yellow PCR master mix (labeled “Master”) in your ice bucket. Transfer 20 µl of the master mix into your PCR tube. Mix by pipetting up and down 2–3 times. Cap the PCR tube tightly and keep it on ice until instructed to proceed to the next step. Avoid bubbles, especially in the bottom of the tubes. 5. Remove your PCR tube from the capless micro test tube and place the tube in the thermal cycler. 6. When all of the PCR samples are in the thermal cycler, the teacher will begin the PCR reaction. The reaction will undergo 35 cycles of amplification, which will take approximately 3 hours. PCR Program: 95oC 95oC 55oC 72oC 72oC 4o C 30 sec 30 sec 30 sec 60 sec 5 min ∞ 35 cycles D. Gel Electrophoresis of Amplified PCR Samples and Staining of Agarose Gels (Protocol) 1. Remove your PCR samples from the thermal cycler and place in the micro test tube holder. If a centrifuge is available, place the PCR tubes in the capless micro test tubes and pulse-spin the tubes (~3 seconds at 2,000 x g) to bring the condensation that formed on the lids to the bottom of the tubes. 85 2. Take 10 µL PCR sample in separate 1.5 mL tubes. 3. Add 2 µl of loading dye to each of 10 µL PCR sample tube and mix gently. 3. Obtain an agarose gel (either the one you poured or one pre-poured by your teacher). ( See Lab 3 protocol) Place the casting tray with the solidified gel in it, onto the platform in the gel box. The wells should be at the cathode (–) end of the box, where the black lead is connected. Very carefully remove the comb from the gel by pulling it straight up, slowly. 4. Pour ~275 ml of electrophoresis buffer into the electrophoresis chamber, until it just covers the wells. 5. Using a clean tip for each sample, 12 µL load the samples into the 8 wells of the gel in the following order: Table XII. Loading sample into gel Lane Sample Load Volume 1 MMR (DNA standard) 12 µl 2 Homozygous (+/+) control 12 µl 3 Homozygous (–/–) control 12 µl 4 Heterozygous (+/–) control 12 µl 5 Student V 12 µl 6 Student X 12 µl 7 Student Y 12 µl 8 Student Z 12 µl 86 6. Secure the lid on the gel box. The lid will attach to the base in only one orientation: red to red and black to black. Connect the electrical leads to the power supply. 7. Turn on the power supply. Set it to 100 V and electrophorese the samples. 8. When electrophoresis is complete (front dye runs upto 80%), turn off the power and remove the lid from the gel box. Carefully remove the gel tray and the gel from the gel box. Be careful, the gel is very slippery. Nudge the gel off the gel tray with your thumb and carefully slide it into your plastic staining tray. Ethidium bromide staining 1. Wear rubber gloves when staining gel, viewing gels, and cleaning up. 2. Confine all staining to sink area restricted from student use. 3. Flood gels with ethidium bromide solution (1 µg/mL), and allow to stain for 5 minutes. (Staining time depends on thickness of gel.) 5. Following staining, use funnel to decant as much ethidium bromide solution as possible from staining tray back into storage container. Results and Discussion 1. Keep a metric ruler beside the gel. 2. Examine your stained gel on a UV transilluminator. 3. Record gel results by taking a picture. 87 4. Measure from front edge of well to front edge of each band. Enter distances into matrix. Alternatively, have students measure distance directly from stained gel or from a photo of their ethidium stained gel. 5. Measure distance travelled by each DNA fragment and enter in the Table below. Table XIII. Information of DNA fragments obtained in different PCR samples. Size Marker Homozygous (+/+) Homozygous (-/-) Heterozygous (+/-) Distance Distance Distance Distance Size Size 88 Size Size 89 Table XIV. Genotypic variation among student population. Student Genotype (number of Group students) number +/+ +/-/- Genotype +/+ +/- -/- I II III IV V Post Lab Questions 1. Explain the difference between an intron and an exon. 2. Why do the two possible PCR products differ in size by 300 base pairs? 3. Explain how agarose electrophoresis separates DNA fragments. Why does a smaller 90 DNA fragment move faster than a larger one? 4. What kind of controls are run in this experiment? Why are they important? Could others be used? 5. What is your genotype for the Alu insert in your PV92 region? 6. What are the genotypic frequencies of +/+, +/–, and –/– in your class population? Fill in the table below with your class data. Table XV. Observed Genotypic Frequencies in the Class Category Number Frequency (# of Genotypes/Total) X 100 Homozygous (+/+) Heterozygous (+/–) Homozygous (–/–) 91 Lab 10-12 Project 3: Mammalian cell culture: morphology, cytoskeleton, actin arrangement Cell culture is a process by which cells are grown under controlled conditions. In practice, the term "cell culture" has come to refer to the culturing of cells derived from multicellular eukaryotes, especially mammalian cells. The historical development and methods of cell culture are closely interrelated to those of tissue culture and organ culture. Animal cell culture became a common laboratory technique in the mid-1900s, but the concept of maintaining live cell lines separated from their original tissue source was discovered in the 19th century. The 19th-century English physiologist Sydney Ringer developed salt solutions containing the chlorides of sodium, potassium, calcium and magnesium suitable for maintaining the beating of an isolated animal heart outside of the body. In 1885 Wilhelm Roux removed a portion of the medullary plate of an embryonic chicken and maintained it in a warm saline solution for several days, establishing the principle of tissue culture. Ross Granville Harrison, working at Johns Hopkins Medical School and then at Yale University, published results of his experiments from 1907–1910, establishing the methodology of tissue culture. Cell culture techniques were advanced significantly in the 1940s and 1950s to support research in virology. Growing viruses in cell cultures allowed preparation of purified viruses for the manufacture of vaccines. The injectable polio vaccine developed by Jonas Salk was one of the first products mass-produced using cell culture techniques. This vaccine was made possible by the cell culture research of John Franklin Enders, Thomas Huckle Weller, and Frederick Chapman Robbins, who were awarded a Nobel Prize for their discovery of a method of growing the virus in monkey kidneycell cultures. 92 Maintaining cells in culture Cells are grown and maintained at an appropriate temperature and gas mixture (typically, 37°C, 5% CO2 for mammalian cells) in a cell incubator. Culture conditions vary widely for each cell type, and variation of conditions for a particular cell type can result in different phenotypes being expressed. Aside from temperature and gas mixture, the most commonly varied factor in culture systems is the growth medium. Recipes for growth media can vary in pH, glucose concentration, growth factors, and the presence of other nutrients. The growth factors used to supplement media are often derived from animal blood, such as calf serum. One complication of these blood-derived ingredients is the potential for contamination of the culture with viruses or prions, particularly in biotechnology medical applications. Current practice is to minimize or eliminate the use of these ingredients wherever possible, but this cannot always be accomplished. Alternative strategies involve sourcing the animal blood from countries with minimum BSE/TSE risk such as Australia and New Zealand, and using purified nutrient concentrates derived from serum in place of whole animal serum for cell culture.[5] Plating density (number of cells per volume of culture medium) plays a critical role for some cell types. For example, a lower plating density makes granulosa cells exhibit estrogen production, while a higher plating density makes them appear as progesterone producing theca lutein cells.[6] Cells can be grown in suspension or adherent cultures. Some cells naturally live in suspension, without being attached to a surface, such as cells that exist in the bloodstream. There are also cell lines that have been modified to be able to survive in suspension cultures so that they can be grown to a higher density than adherent conditions would allow. Adherent cells require a surface, such as tissue culture plastic or microcarrier, which may be coated with extracellular matrix 93 components to increase adhesion properties and provide other signals needed for growth and differentiation. Most cells derived from solid tissues are adherent. Another type of adherent culture is organotypic culture which involves growing cells in a three-dimensional environment as opposed to two-dimensional culture dishes. This 3D culture system is biochemically and physiologically more similar to in vivo tissue, but is technically challenging to maintain because of many factors (e.g. diffusion). Materials. 1. NIH 3T3 cells 2. DMEM with 10% FCS 3. Gloves 18. Forcep 19. Microscope 4. Paper towel, waste container 5. Micropipettes and tips 6. 24 well cell culture plate 7. Cover glass 8. Microscope 9. CO2 incubator 10. Water bath: 37oC 11. Cell culture hood 12. Weighing balance, weighing boat/paper 13. 16% Paraformaldehyde (formaldehyde) aqueous solution (Electron Microscopy Sciences) 14. PBS 15. Alexa Fluor® 488 phalloidin (Invitrogen) 16. 0.1% Triton X-100 17. Microscope slides 94 DETERMINING CELL NUMBER AND VIABILITY WITH A HEMACYTOMETER AND TRYPAN BLUE STAINING 1. Determining the number of cells in culture is important in standardization of culture conditions and in performing accurate quantitation experiments. A hemacytometer is a thick glass slide with a central area designed as a counting chamber. The exact design of the hemacytometer may vary; the one described here is the Improved Neubauer from Baxter Scientific (Fig. below ). 2. The central portion of the slide is the counting platform which is bordered by a 1-mm groove. The central platform is divided into two counting chambers. This grid is divided into nine secondary squares. The four corner squares and the central square are used for determining the cell count. The corner squares are further divided into 16 tertiary squares and the central square into 25 tertiary squares to aid in cell counting. Accompanying the hemacytometer slide is a thick, even-surfaced coverslip. Ordinary coverslips may have uneven surfaces that can introduce errors in cell counting; therefore, it is imperative that the coverslip provided with the hemacytometer is used in determining cell number. 95 3. Cell suspension is applied to a defined area and counted so cell density can be calculated.y a transverse groove. Each counting chamber consists of 1 to 4). 4. Dilute cells as needed to obtain a uniform suspension. Disperse any clumps. When using the hemacytometer, a maximum cell count of 20 to 50 cells per 1 x 1–mm square is recommended. 5. Load hemacytometer Use a sterile Pasteur pipet to transfer cell suspension to edge of hemacytometer counting chamber. Hold tip of pipet under the coverslip and dispense one drop of suspension. Suspension will be drawn under the coverslip by capillary action. The hemacytometer should be considered nonsterile. If cell suspension is to be used for cultures, do not reuse the pipet and do not return any excess cell suspension in the pipet to the original suspension. 6. Fill second counting chamber. Count cells 7. Allow cells to settle for a few minutes before beginning to count. Blot off excess liquid. 8. View slide on microscope with total 100X magnification. A 10X ocular with a 10X objective = 100Xmagnification. Position slide to view the large central area of the grid; this area is bordered by a set of three parallel lines. The central area of the grid should almost fill the microscope field. Subdivisions within the large central area are also bordered by three parallel lines and each subdivision is divided into sixteen smaller squares by single lines. Cells within this area should be evenly distributed without clumping. 96 9. Count cells in sixteen small squares. Repeat counts for other counting chamber and enter number in the table below. Count cells touching the middle line of the squares. Calculate cell number 10. Determine cells per milliliter by the following calculations: cells/ml = average count per sixteen squares X dilution factor 104 Total number of cells = cells/ml X volume of cell suspension (in ml). The number 104 is the volume correction factor for the hemacytometer: each square is 1 X 1 mm and the depth is 0.1 mm. Table XVI. Cell count in different samples. Cell type Square # Cell # Cell #/Sq Living (colorless) Non-living (red color) 97 Cell/ml Total # Formaldehyde Fixation and Staining Actin Filaments with Fluorescent-Phalloidin 1. Fix in 4% formaldehyde (16% stock EM grade) in CBS for 20 minutes 2. Rinse in TBS 3. Permeabilize in TBS-0.5% TX for 10 minutes 4. Rinse in TBS-0.1% TX (3 changes in 3-5 minutes is adequate) 5. Block in Abdil for 10 minutes 6. Incubate in fluorescent-phalloidin (1ug/ml from 1mg/ml frozen stock in DMSO) for 20 minutes at room temperature. Do not incubate for longer than 20 minutes; highly 98 fluorescent compounds such as fluorescent-phalloidin are usually sticky and will increase background staining with longer incubations. 7. Wash in TBS-0.1% TX 8. Incubate in 1-10ug/ml DAPI or Hoesht in Abdil to stain nuclei if required for 10 minutes 9. Wash in TBS-0.1% TX 10. Rinse in TBS 11. Drain, mount, seal 12. When sealed add water to the top of the coverslip, then aspirate. 99 Lab report: 1. List chemical factors required for mammalian cell culture. 2. List physical and environmental factors required for mammalian cell culture. 3. Draw a cells appeared (morphology) in a microscopic field at a total magnification of 100 X. 4. Define the following terms: focal adhesion, filopodia, lamellepodia. 5. Draw a typical mammalian cell showing focal adhesion, filopodia, lamellipodia. 100 Lab 13 and 14 Project 4. Polymerase Chain Reaction: Genetically Modified Organism Investigation With the world population exploding and farmable land disappearing, agricultural specialists are concerned about the world's ability to produce enough food to feed the growing population. Environmentalists are concerned about the overuse of pesticides and herbicides and the long-term effects of these chemicals on the environment and human health. Might there be a solution to both of these problems? The biotechnology industry thinks so. Its proponents believe genetically modified organisms (GMOs), particularly genetically modified (GM) crop plants, can solve both problems. This proposed solution, however, has met with great opposition throughout the world. Dubbed "frankenfoods" by opponents and restricted in most European countries, GMOs are widely produced and sold in the United States. Currently in the US, foods that contain GMOs do not have to be labeled as such. Genetic manipulation of crop plants is not new. Farmers have been genetically modifying crops for centuries and crop breeding to encourage specific traits, such as high yield, is still an important part of agriculture today. However, there is now the option to place genes for selected traits directly into crop plants. These genes do not have to originate from the same plant species—in fact, they do not have to come from plants at all. One popular class of GM crops has a gene from the soil bacterium Bacillus thuringiensis (Bt) inserted into their genomes. Bt crops produce a protein called delta-endotoxin that is lethal to European corn borers, a common pest on corn plants. Farmers who pla...
Purchase answer to see full attachment