DNA structure and function assignment

Anonymous
timer Asked: Oct 24th, 2018
account_balance_wallet $15

Question description

I attached the assignment instructions and Heres links that my teacher gave me for this assignment : https://youtu.be/5qSrmeiWsuc

https://youtu.be/oefAI2x2CQM


Please follow the directions

DNA structure and function assignment
26c2318b_dc69_41d3_a691_c4a4fe1c7df5.png

Tutor Answer

Proheim
School: Carnegie Mellon University

Attached.

Running head: DNA STRUCTURE AND FUNCTION

DNA Structure and Function
Student Name:
Institutional Affiliation:
Date:

1

DNA STRUCTURE AND FUNCTION

2

Question 1: DNA Molecular structure
The molecules that make up Deoxyribonucleic acid (DNA) are called nucleotides. The
nucleotide has: nitrogen base, sugar group and a phosphate group. Nitrogen bases are of four
types namely: guanine (G), cytosine (C), thymine (T) and adenine (A). Hydrogen bonds are used
to pair the nitrogenous bases to each other, hence base pairs are said to be complementary. In the
base pairs, adenine pair up with thymine (A-T) while guanine pair up with cytosine (C-G).
Question 2: Complementary strand of DNA
The complementary strand of this DNA: TACTGACCAAAACCGGGCTCTACT is
ATGACTGGTTTTGGCCCGAGATGA
Question 3: Semi-conservative replication
Semi-conservative replication is a term that describes the process through which DNA is
replicated in cells. In the mechanism...

flag Report DMCA
Review

Anonymous
Outstanding Job!!!!

Similar Questions
Hot Questions
Related Tags

Brown University





1271 Tutors

California Institute of Technology




2131 Tutors

Carnegie Mellon University




982 Tutors

Columbia University





1256 Tutors

Dartmouth University





2113 Tutors

Emory University





2279 Tutors

Harvard University





599 Tutors

Massachusetts Institute of Technology



2319 Tutors

New York University





1645 Tutors

Notre Dam University





1911 Tutors

Oklahoma University





2122 Tutors

Pennsylvania State University





932 Tutors

Princeton University





1211 Tutors

Stanford University





983 Tutors

University of California





1282 Tutors

Oxford University





123 Tutors

Yale University





2325 Tutors