Description
Write A method in C++ language, using either vector maps or sets which one of them does the job and see the picture provided to get the idea of the whole thing every thing is written in the picture attached
,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,
Unformatted Attachment Preview
Problem 6: Write a method that shows the list of the codons and
how many times each codon that appears in a DNA segment.
(*) You may use vector, set, or map containers in order to create
a hash table and store frequency values of each codon that
appears in the given DNA segment.
Reference: https://www.nature.com/scitable/definition/codon-155
For example:
tacgagcgtgtgctgaaacaaatgaagggccgctacgataaggaacttogtaatttcaga
would produce
tac => 2
age => 1
cgt => 2
tCa => 1
taa => 2
tcg => 1
gta => 1
gat => 1
tgt => 1
ctt => 1
ctg => 1
gaa => 3
aat => 2
caa => 1
gga => 1
ata => 1
atg => 1
gcc => 1
ccg => 1
act => 1
acg => 2
ttt => 1
gcg => 1
tga => 2
aac => 2
ggc => 1
cga => 2
cag => 1
cgc => 1
agg => 2
aga => 1
aag => 2
aaa => 2
att => 1
ttc=> 2
aca => 1
cta => 1
gtg => 2
get => 2
tge => 1
ggg => 1
gag => 1
Purchase answer to see full attachment
Purchase answer to see full attachment
User generated content is uploaded by users for the purposes of learning and should be used following Studypool's honor code & terms of service.
Explanation & Answer
Hello, here you go...
Completion Status:
100%
Review
Review
Anonymous
Really helped me to better understand my coursework. Super recommended.
Studypool
4.7
Trustpilot
4.5
Sitejabber
4.4
24/7 Homework Help
Stuck on a homework question? Our verified tutors can answer all questions, from basic math to advanced rocket science!
Most Popular Content
WEBD122 Case Study Scenario. DQ
Part 2:Please respond to this Question-Case Study: (You may wait until Wed. to post this portion after you have had a chan ...
WEBD122 Case Study Scenario. DQ
Part 2:Please respond to this Question-Case Study: (You may wait until Wed. to post this portion after you have had a chance to read a few articles in the Lessons area or completed some outside research. Please post your introduction first.)You own the "SweetTooth" Candy store and you have been in business for the last three years. Your store location in the strip mall is ideal and business is great. You have had a website up and running now for two years. The website only displays a listing of all the candy treats your store offers with brief descriptions.During this time your webmaster has been keeping web statistics on visitors to your website. You have been receiving numerous requests and emails from your customers to start selling your candy over the Internet.You ask your webmaster to forward the Web Statistics to you, the complete history of the visitors and the pages they visited.NOTE: Class, try not to over analyze this first forum, look at the scenario from the perspective of the store owner and how you would base your decision to move forward. YOUR QUESTIONS:What information would you look for in the Web Stats to help you make a decision to go forward with the request to offer sales through your website?Would you disregard the emails customer requests to sell your candy through your website? How would the web stats play a role? (if many visitors, if few visitors)Please use APA formatting and in text cititation Please No Plagiarism
George Mason University Covid Dataset R Coding Computer Programming Task
All the instructions are hopefully all attached in the document, I just need the codes for the steps, let me know if anyth ...
George Mason University Covid Dataset R Coding Computer Programming Task
All the instructions are hopefully all attached in the document, I just need the codes for the steps, let me know if anything else is needed from my end
Calculate gross pay
Write a C program that will calculate the gross pay of a set of employees utilizing pointers instead of array refernces.Th ...
Calculate gross pay
Write a C program that will calculate the gross pay of a set of employees utilizing pointers instead of array refernces.The program should prompt the user to enter the number of hours each employee worked. When prompted, key in the hours shown below.The program determines the overtime hours (anything over 40 hours), the gross pay and then outputs a table in the following format. Column alignment, leading zeros in Clock#, and zero suppression in float fields is important. Use 1.5 as the overtime pay factor.This week, adding a Total and Average row is no longer optional, its required for this assignment:a) Add a Total row at the end to sum up the wage, hours, ot, and gross columnsb) Add an Average row to print out the average of the wage, hours, ot, and gross columns ---------------------------------------------------------
Name Clock# Wage Hours OT Gross
---------------------------------------------------------
Connie Cobol 098401 10.60 51.0 11.0 598.90
Mary Apl 526488 9.75 42.5 2.5 426.56
Frank Fortran 765349 10.50 37.0 0.0 388.50
Jeff Ada 034645 12.25 45.0 5.0 581.88
Anton Pascal 127615 10.00 40.0 0.0 400.00
---------------------------------------------------------
Total: 53.10 215.5 18.5 2395.84
Average: 10.62 43.1 3.7 479.19
You should implement this program using a structure similar to the suggested one below to store the information for each employee. Feel free to tweak it if you wish. For example, its OK to have a first and last name member instead of just a name member, and if you want to use different types, that is OK as well. struct employee
{
char name [20];
long id_number;
float wage;
float hours;
float overtime;
float gross;
}; Set a pointer to it and then use that pointer going forward to access elements (and their associated members) in your array of structures. Again, do not use array references with indexes (use emp_ptr->hours ... not ... emp [ i ].hours as the latter is not a fast).Use the following information to initialize your data. Connie Cobol 98401 10.60
Mary Apl 526488 9.75
Frank Fortran 765349 10.50
Jeff Ada 34645 12.25
Anton Pascal 127615 10.00
Create an array of structures with 5 elements, each being of type struct employee. Initialize the array with the data provided and reference the elements of the array with the appropriate subscripts.Do not use any array references with indexes. For example:emp[i].wage /* this is bad, it uses an array reference with an index, in this case, i */emp_ptr->wage; /* this is good, it uses a pointer to reference the wage value */Here is template************************************************************************/
/* */
/* HOMEWORK: 7 */
/* */
/* Name: Joe Student */
/* */
/* Class: C Programming, Cybercourse */
/* */
/* Date: <add your date> */
/* */
/* Description: Program which determines gross pay based on overtime */
/* and outputs a formatted answer. Employee information */
/* is stored in an array of structures and referenced */
/* through the use of pointers. */
/************************************************************************/
#include <stdio.h>
#include <stdlib.h>
/* define all constants here */
#define SIZE 5
/* type to hold employee information */
struct employee
{
char name [20]; /* Employee first and last name */
int id; /* unique employee identifier */
float wage; /* hourly wage rate */
float hours; /* hours worked in a given week */
float overtime; /* hours worked after the standard work week */
float gross; /* total gross pay, standard pay + overtime pay */
};/* add function prototypes here if you wish */
/* Remember to add function comment header block for each function *//* like shown below for printData, a stub for getHours is below. */
void getHours ( struct employee * emp_ptr, int size )
{
}
/************************************************************************/
/* Function: printData */
/* */
/* Purpose: Outputs to screen in a table format the following: */
/* - Employee First and Last Name */
/* - Employee clock number */
/* - Wage rate for an employee. */
/* - Total hours worked by employee. */
/* - Overtime Hours. */
/* - Gross Pay. */
/* */
/* Parameters: emp_ptr - pointer to array of structures */
/* size - number of employees to process */
/* */
/* Returns: Nothing, since emp_ptr is passed by reference */
/************************************************************************/
void printData ( struct employee * emp_ptr, int size )
{
int n; /* counter used in for loop to keep track of iterations */
/* prints the output for all employees to the screen */
for (n = 0; n < SIZE; n++)
{
printf ("%-20.20s %06i $%5.2f %4.1f %4.1f $%7.2f \n",
emp_ptr->name,
emp_ptr->id,
emp_ptr->wage,
emp_ptr->hours,
emp_ptr->overtime,
emp_ptr->gross);
++emp_ptr; /* move to next employee */
}
printf ("\n");
}
/************************************************************************/
/* Function: Main */
/************************************************************************/
int main()
{
/* A structure array to hold information on employees */
struct employee emp [SIZE] = { {"Connie Cobol", 98401, 10.60},
{"Frank Fortran", 526488, 9.75},
{"Mary Apl", 765349, 10.50},
{"Jeff Ada", 34645, 12.25},
{"Anton Pascal", 127615, 10.0}
};
/* Get user input for the hours worked for each employee */
getHours ( emp, SIZE );
/* Calculate overtime for each employee */
/* Calculate gross pay for each employee */ /* Print column headers for each employee */ /* Print employee data to the screen */
printData ( emp, SIZE );
return 0;
}
discussion 7 Network protocol
submit a list of protocols that would be running on your project network, and if you decided to change the ports, please s ...
discussion 7 Network protocol
submit a list of protocols that would be running on your project network, and if you decided to change the ports, please specify.·Name the switch in your project layout as the one you found, if it not available in Packet Tracer.
IT 100 Milestone One Guidelines and Rubric: Business Letter, assignment help
Overview: As you prepare to communicate the next steps in the consulting partnership between your organization, Business C ...
IT 100 Milestone One Guidelines and Rubric: Business Letter, assignment help
Overview: As you prepare to communicate the next steps in the consulting partnership between your organization, Business Consultants, and your client, New
Hampshire Business Products, you will prepare three deliverable using office productivity applications. For Milestone One, you will prepare a draft of your first
deliverable: a business letter created with Microsoft Word. You will be required to format and revise the business letter to summarize the findings of your initial
meeting with the client and to request a follow-up meeting, using formatting and style conventions appropriate for the identified audience. Prompt: First, review this scenario. Then apply audience-appropriate formatting and style conventions to a follow-up business letter for New Hampshire
Business Products. Use the business letter content in this document. Specifically, the following critical elements must be addressed: I. Business Letter: Apply audience-appropriate formatting and style conventions to a follow-up business letter for New Hampshire Business Products. Use
the business letter content in the Word document provided.
A. Incorporate the business letter content into a business letter template. Word provides a business letter template. B. Apply formatting conventions appropriate for the intended audience.
1. Select a standard and consistent font and font size.
2. Format the document with standard and consistent line spacing, margins, and indentation.
3. Configure the data provided into a chart format.
C. Apply revisions to the provided draft to produce a document that is clear of typographical and formatting errors.
Rubric
Guidelines for Submission: Your business letter must be submitted as a 1- to 2-page Microsoft Word document. Save the provided document to your computer
and submit the revised version with the following naming convention: businessletter_v.2_firstinitiallastname.docx. No plargrism or copying anyone's papers and the document and scenario is provided please use
Similar Content
CSCI 2493 Withdraw Funds Function for a Bank Account Project
Proposal: Bank Functioning
Project Name: Bank project.java
Description:
•
•
•
•
•
•
•
•
Create a class B...
Basic HTML/CSS
Basic HTML <html></html> ==> start and end document <h1></h1> ==> header size 1-6 <p&g...
ITS 632 University of Cumberlands Average Rainfall Custom Function Coding Project
Write a program that uses nested loops to collect data and calculate the average rainfall over a period of years. This pro...
Saint Leo University Walmart Managerial Finance Paper
The Final Paper will involve applying the concepts learned in class to an analysis of a company using data from its annual...
What is scope, context and closures in Javascript?
I need a detailed explanation of these 3 concepts in Javascript.Give me code examples....
KFU C++ Compute Computational Complexity of Your Algorithm Project
The assignment is two questions and writing a rental movie program in C++ with those requirements in pic below, this is th...
As Student Who Have Learned Its 320 Basic Programming Course On Python.edited
As a student who has learned the ITS 320 introductory programming course on Python, there are vital lessons and things tha...
Sol2
public static void searchBinary(int[] info, int number, int aV) // initilised mid varible to find mid of the Array info[]...
Linux
Explain which implementation of the protection matrix is more suitable for the following (a) Granting read access to a fil...
Related Tags
Book Guides
Get 24/7
Homework help
Our tutors provide high quality explanations & answers.
Post question
Most Popular Content
WEBD122 Case Study Scenario. DQ
Part 2:Please respond to this Question-Case Study: (You may wait until Wed. to post this portion after you have had a chan ...
WEBD122 Case Study Scenario. DQ
Part 2:Please respond to this Question-Case Study: (You may wait until Wed. to post this portion after you have had a chance to read a few articles in the Lessons area or completed some outside research. Please post your introduction first.)You own the "SweetTooth" Candy store and you have been in business for the last three years. Your store location in the strip mall is ideal and business is great. You have had a website up and running now for two years. The website only displays a listing of all the candy treats your store offers with brief descriptions.During this time your webmaster has been keeping web statistics on visitors to your website. You have been receiving numerous requests and emails from your customers to start selling your candy over the Internet.You ask your webmaster to forward the Web Statistics to you, the complete history of the visitors and the pages they visited.NOTE: Class, try not to over analyze this first forum, look at the scenario from the perspective of the store owner and how you would base your decision to move forward. YOUR QUESTIONS:What information would you look for in the Web Stats to help you make a decision to go forward with the request to offer sales through your website?Would you disregard the emails customer requests to sell your candy through your website? How would the web stats play a role? (if many visitors, if few visitors)Please use APA formatting and in text cititation Please No Plagiarism
George Mason University Covid Dataset R Coding Computer Programming Task
All the instructions are hopefully all attached in the document, I just need the codes for the steps, let me know if anyth ...
George Mason University Covid Dataset R Coding Computer Programming Task
All the instructions are hopefully all attached in the document, I just need the codes for the steps, let me know if anything else is needed from my end
Calculate gross pay
Write a C program that will calculate the gross pay of a set of employees utilizing pointers instead of array refernces.Th ...
Calculate gross pay
Write a C program that will calculate the gross pay of a set of employees utilizing pointers instead of array refernces.The program should prompt the user to enter the number of hours each employee worked. When prompted, key in the hours shown below.The program determines the overtime hours (anything over 40 hours), the gross pay and then outputs a table in the following format. Column alignment, leading zeros in Clock#, and zero suppression in float fields is important. Use 1.5 as the overtime pay factor.This week, adding a Total and Average row is no longer optional, its required for this assignment:a) Add a Total row at the end to sum up the wage, hours, ot, and gross columnsb) Add an Average row to print out the average of the wage, hours, ot, and gross columns ---------------------------------------------------------
Name Clock# Wage Hours OT Gross
---------------------------------------------------------
Connie Cobol 098401 10.60 51.0 11.0 598.90
Mary Apl 526488 9.75 42.5 2.5 426.56
Frank Fortran 765349 10.50 37.0 0.0 388.50
Jeff Ada 034645 12.25 45.0 5.0 581.88
Anton Pascal 127615 10.00 40.0 0.0 400.00
---------------------------------------------------------
Total: 53.10 215.5 18.5 2395.84
Average: 10.62 43.1 3.7 479.19
You should implement this program using a structure similar to the suggested one below to store the information for each employee. Feel free to tweak it if you wish. For example, its OK to have a first and last name member instead of just a name member, and if you want to use different types, that is OK as well. struct employee
{
char name [20];
long id_number;
float wage;
float hours;
float overtime;
float gross;
}; Set a pointer to it and then use that pointer going forward to access elements (and their associated members) in your array of structures. Again, do not use array references with indexes (use emp_ptr->hours ... not ... emp [ i ].hours as the latter is not a fast).Use the following information to initialize your data. Connie Cobol 98401 10.60
Mary Apl 526488 9.75
Frank Fortran 765349 10.50
Jeff Ada 34645 12.25
Anton Pascal 127615 10.00
Create an array of structures with 5 elements, each being of type struct employee. Initialize the array with the data provided and reference the elements of the array with the appropriate subscripts.Do not use any array references with indexes. For example:emp[i].wage /* this is bad, it uses an array reference with an index, in this case, i */emp_ptr->wage; /* this is good, it uses a pointer to reference the wage value */Here is template************************************************************************/
/* */
/* HOMEWORK: 7 */
/* */
/* Name: Joe Student */
/* */
/* Class: C Programming, Cybercourse */
/* */
/* Date: <add your date> */
/* */
/* Description: Program which determines gross pay based on overtime */
/* and outputs a formatted answer. Employee information */
/* is stored in an array of structures and referenced */
/* through the use of pointers. */
/************************************************************************/
#include <stdio.h>
#include <stdlib.h>
/* define all constants here */
#define SIZE 5
/* type to hold employee information */
struct employee
{
char name [20]; /* Employee first and last name */
int id; /* unique employee identifier */
float wage; /* hourly wage rate */
float hours; /* hours worked in a given week */
float overtime; /* hours worked after the standard work week */
float gross; /* total gross pay, standard pay + overtime pay */
};/* add function prototypes here if you wish */
/* Remember to add function comment header block for each function *//* like shown below for printData, a stub for getHours is below. */
void getHours ( struct employee * emp_ptr, int size )
{
}
/************************************************************************/
/* Function: printData */
/* */
/* Purpose: Outputs to screen in a table format the following: */
/* - Employee First and Last Name */
/* - Employee clock number */
/* - Wage rate for an employee. */
/* - Total hours worked by employee. */
/* - Overtime Hours. */
/* - Gross Pay. */
/* */
/* Parameters: emp_ptr - pointer to array of structures */
/* size - number of employees to process */
/* */
/* Returns: Nothing, since emp_ptr is passed by reference */
/************************************************************************/
void printData ( struct employee * emp_ptr, int size )
{
int n; /* counter used in for loop to keep track of iterations */
/* prints the output for all employees to the screen */
for (n = 0; n < SIZE; n++)
{
printf ("%-20.20s %06i $%5.2f %4.1f %4.1f $%7.2f \n",
emp_ptr->name,
emp_ptr->id,
emp_ptr->wage,
emp_ptr->hours,
emp_ptr->overtime,
emp_ptr->gross);
++emp_ptr; /* move to next employee */
}
printf ("\n");
}
/************************************************************************/
/* Function: Main */
/************************************************************************/
int main()
{
/* A structure array to hold information on employees */
struct employee emp [SIZE] = { {"Connie Cobol", 98401, 10.60},
{"Frank Fortran", 526488, 9.75},
{"Mary Apl", 765349, 10.50},
{"Jeff Ada", 34645, 12.25},
{"Anton Pascal", 127615, 10.0}
};
/* Get user input for the hours worked for each employee */
getHours ( emp, SIZE );
/* Calculate overtime for each employee */
/* Calculate gross pay for each employee */ /* Print column headers for each employee */ /* Print employee data to the screen */
printData ( emp, SIZE );
return 0;
}
discussion 7 Network protocol
submit a list of protocols that would be running on your project network, and if you decided to change the ports, please s ...
discussion 7 Network protocol
submit a list of protocols that would be running on your project network, and if you decided to change the ports, please specify.·Name the switch in your project layout as the one you found, if it not available in Packet Tracer.
IT 100 Milestone One Guidelines and Rubric: Business Letter, assignment help
Overview: As you prepare to communicate the next steps in the consulting partnership between your organization, Business C ...
IT 100 Milestone One Guidelines and Rubric: Business Letter, assignment help
Overview: As you prepare to communicate the next steps in the consulting partnership between your organization, Business Consultants, and your client, New
Hampshire Business Products, you will prepare three deliverable using office productivity applications. For Milestone One, you will prepare a draft of your first
deliverable: a business letter created with Microsoft Word. You will be required to format and revise the business letter to summarize the findings of your initial
meeting with the client and to request a follow-up meeting, using formatting and style conventions appropriate for the identified audience. Prompt: First, review this scenario. Then apply audience-appropriate formatting and style conventions to a follow-up business letter for New Hampshire
Business Products. Use the business letter content in this document. Specifically, the following critical elements must be addressed: I. Business Letter: Apply audience-appropriate formatting and style conventions to a follow-up business letter for New Hampshire Business Products. Use
the business letter content in the Word document provided.
A. Incorporate the business letter content into a business letter template. Word provides a business letter template. B. Apply formatting conventions appropriate for the intended audience.
1. Select a standard and consistent font and font size.
2. Format the document with standard and consistent line spacing, margins, and indentation.
3. Configure the data provided into a chart format.
C. Apply revisions to the provided draft to produce a document that is clear of typographical and formatting errors.
Rubric
Guidelines for Submission: Your business letter must be submitted as a 1- to 2-page Microsoft Word document. Save the provided document to your computer
and submit the revised version with the following naming convention: businessletter_v.2_firstinitiallastname.docx. No plargrism or copying anyone's papers and the document and scenario is provided please use
Earn money selling
your Study Documents