Description
- How does DNA differ from RNA? (2 points)
- Where in the cell does each of the following processes take place? (2 points)
- Transcription
- Translation
- The following is a base sequence on a strand of DNA. When the strand replicates, what is the base sequence on the complementary strand of DNA? (2 points)
AATCGCATACCCGGTCAG
- Transcribe the following DNA molecule into mRNA: TAACCTGGACTACAAATC. (2 points)
- What is a promoter? (2 points)
- What is the role of the enzyme DNA polymerase? (2 points)
- What is the end product of transcription? (2 points)
- Why would it be impossible to extract DNA from cooked foods? (2 points)
- Which DNA extraction procedure (warm water versus room temperature water) produced a greater quantity of DNA? Explain why the results turned out the way that they did. (6 points)
- Provide the amino acid sequence for DNA template cards 1 through 5 (from Procedure 4 in the lab)? (10 points)
- DNA template card # 1:
- DNA template card # 2:
- DNA template card # 3:
- DNA template card # 4:
- DNA template card # 5:
- What is an exon? (2 points)
- What three molecules are needed for the process of translation? (3 points)
- What are the building blocks of proteins called? (2 points)
- List the three stop codons. (3 points)
- Provide the amino acid sequence for DNA template cards 6 through 10 (from Procedure 4). (10 points)
- DNA template card # 6:
- DNA template card # 7:
- DNA template card # 8:
- DNA template card # 9:
- DNA template card # 10:
- Define the following terms: (2 points)
- Point mutation
- Frameshift mutation
- Name the type of mutation that occurred below. (2 points)
- Provide the amino acid sequence for DNA template cards 5 and 11 through 14 (from Procedure 4). (10 points)
- DNA template card #5:
- DNA template card # 11:
- DNA template card # 12:
- DNA template card # 13:
- DNA template card # 14:
- DNA template cards 11 through 14 represent mutations that occurred in template card five. Review the amino acid sequences for cards 5 and 11 through 14 and answer the following: (10 points)
- What type of mutation occurred in cards 11 and 12?
- Did the mutation in card 11 result in a change in the protein synthesized?
- Did the mutation in card 12 result in a change in the protein synthesized?
- What type of mutation occurred in cards 13 and 14?
- Would the mutations that occurred in cards 13 and 14 result in a change in the protein synthesized?
- A base deletion of base eight (frameshift mutation) occurs in the following nucleotide sequence: CTCAATGAAGGCCTA. (4 points)
- Write the codons for the nucleotide sequence.
- Write the codons for the nucleotide sequence following the base deletion.
- (Application) How might the information gained from this lab pertaining to protein synthesis be useful to you in your everyday life or to a healthcare professional? (20 points)
- Demonstrates application and comprehension of the scientific principles.
- Displays competence in applying scientific knowledge to your personal or professional life.
- Relevant content is supported by facts, data, and detailed examples.
- The application paragraph is organized and structured.
Original strand of DNA: CTAGGCCTAACTGCC
Replicated strand of DNA: CTAGGCCAAACTGCC
Key components of critical thinking and application include the following:
Explanation & Answer
Kindly see attached file with the answer to the rest of the questions.I'm at your complete disposal to finish the missing ones as soon as you upload the information related to the DNA sequence on the rest of DNA cards.
1.
The main differences between DNA and RNA are:
- DNA has two nucleotide strands, while RNA has only one strand
- DNA is a linear double helix, while RNA is in most cases circular
- The nucleotide bases of DNA are adenine, cytosine, guanine and thyimine, while those of
RNA are adenine, cytosine, guanine and uracil.
2.
- Transcription takes place in the cell’s nucleus
- Translation takes place in the ribosomes present in the endoplasmic reticulum
3.
The complementary sequence would be TTAGCGTATGGGCCAGTC
4.
The transcribed sequence would be AUUGGACCUGAUGUUUAG
5.
A promoter is the region of the DNA that starts the transcription of the gene coded in the DNA
sequence. In some specific cases, it also represents the place where the RNA polymerase binds
the DNA molecule to start the transcription process.
A typical example of a promoter is the TATA box, a sequence of T-A-T-A nucleotides that serves
as binding point for the RNA polymerase
6.
The DNA polymerase regulates the replication process, through which an identical copy of the
DNA strand is created.
7.
The end product of the transcription process is a mRNA molecule whose sequence is
complementary to that of the DNA molecule used as template except for the fact that, since it
is a RNA molecule, uracyl will replace thymine as the complementary base for adenine.
8.
It is impossible to extract DNA from cooked foods because the DNA molecule will most
probably break up at the high temperatures used for cooking the food.
9.
The DNA extraction procedure that produced a higher amount of DNA was the one using room
temperature water. I expect that this is due to the fact that the solubility of DNA in the water
was higher when using warm water instead of room temperature water, such that it could not
be easily precipitated from the solution to be able of isolating it.
10.
DNA template card 1:
TACTTACCGAGATTCTTGTTTATC
Transcribed mRNA molecule:
AUGAAUGGCUCUAAGAACAAAUAG
Codons:
AUG-AAU-GGC-UCU-AAG-AAC-AAA-UAG
Resulting amino acid sequence:
Met-Asn-Gly-Ser-Lys-Asn-Lys-Stop
DNA template card 2:
Transcribed mRNA molecule:
Codons:
Resulting amino acid sequence:
DNA template card 3:
Transcribed mRNA molecule:
Codons:
Resulting amino acid sequence:
DNA template card 4:
Transcribed mRNA molecule:
Codons:
Resulting amino acid sequence:
DNA template card 5:
Transcribed mRNA molecule:
Codons:
Resulting amino acid sequence:
11.
A exon is the region of the gene that codifies for the synthesis of a protein and that is
submitted to the translation process.
12.
The tree molecules necessary for the translation process are:
-
The DNA molecule, that serves as template of the genetic code
The mRNA molecule, complementary to the DNA molecule and that acts as
intermediary in the translation process
The tRNA molecules, that links to the corresponding codons in the mRNA molecule and
brings the aminoacids close together so that they can be bound and form the protein
13.
The building blocks of proteins are the amino acids
14.
The three stop codons are:
-
UAA
UAG
UGA
15.
DNA template card 6:
Transcribed mRNA molecule:
Codons:
Resulting a...
Review
Review
24/7 Homework Help
Stuck on a homework question? Our verified tutors can answer all questions, from basic math to advanced rocket science!
Similar Content
Related Tags
The Color Purple
by Alice Walker
The Magic Mountain
by Thomas Mann
A Brief History of Humankind Sapiens
by Yuval Noah Harari
The Curious Case of the Dog in the Night Time
by Mark Haddon
Twilight
by Stephenie Meyer
Homo Deus
by Yuval Noah Harari
Othello
by Wiliam Shakespeare
The Lost Man
by Jane Harper
Hidden Figures
by Margot Lee Shetterly