How to digest a DNA sequence with 2 restriction enzymes to insert into a plasmid cut by the same enzymes?

Anonymous
timer Asked: Oct 27th, 2018

Question description

I must produce a protein JuicyJoy using recombinant DNA methods. JuicyJoy is a small polypeptide (~50 amino acids). The given DNA sequence (with the polypeptide in bold font) is as follows:

(5’)TGACAATTCTGCAGAATACTCTTAGAGACTGTAGGAAAAAACATTCTATAACTTT CCTTAGTAAGTTCTGTTTCCACCGTTAGAATCAAGAATTCCTATAATATCCAATTTGG ATCCTCTCCTCCTGAAATTTTCGTGTATTTCGTCTAGTTGTATCCTCAGAGAATTCTTA AGCTGCCTGCCTGTGGTCGATGTAGAGGATCTTTATGATCATCATTGCCCGGAGTGC AATGGCATGATCTCGGCTCACTGCAACCTCCGCCTCCTGGGTTTTAGCAGTCATTAG TTGAGTTAACGAGAATTCTGGATCCTATTCAGACACATGCCGAGGACGAAGGCACCT GCAGAAGATTAACAGGGGCTTGGCCTGGGAGGATACGACCAACGGACCCCAAACAG CAGGGGGACGCCGACGGAGGCAGAAAGACTGCAACCACAAGACAAGAAGGC(3’)

The challenge is to manipulate the coding sequence so I can express the gene in E. coli and start making JuicyJoy. I have an expression vector that contains the gene for beta galactosidase (and associated regulatory elements) into which foreign genes are cloned. The result is a fusion protein consisting of several amino acid residues of beta galactosidase linked to the amino acids specified by the foreign gene. Insertion sites for foreign DNA are defined by restriction sites within the galactosidase gene for the restriction enzymes Eco R1, a Bam H1, and Pst 1, all of which are in the proper reading frame for translation. Of course, any foreign gene inserted into one of these sites must also be inserted not only in the correct reading frame but also in the correct orientation for proper translation of the protein product. The most efficient subcloning of the gene occurs when the gene can only be inserted into the vector in one orientation as opposed to being inserted in both forward and backwards fashion (i.e. in a way that only allows the 5'end of the gene to be inserted into the vector in the appropriate orientation).

How do I go about completing this challenge?

Tutor Answer

(Top Tutor) Studypool Tutor
School: Cornell University
Studypool has helped 1,244,100 students
flag Report DMCA
Similar Questions
Hot Questions
Related Tags

Brown University





1271 Tutors

California Institute of Technology




2131 Tutors

Carnegie Mellon University




982 Tutors

Columbia University





1256 Tutors

Dartmouth University





2113 Tutors

Emory University





2279 Tutors

Harvard University





599 Tutors

Massachusetts Institute of Technology



2319 Tutors

New York University





1645 Tutors

Notre Dam University





1911 Tutors

Oklahoma University





2122 Tutors

Pennsylvania State University





932 Tutors

Princeton University





1211 Tutors

Stanford University





983 Tutors

University of California





1282 Tutors

Oxford University





123 Tutors

Yale University





2325 Tutors